Incidental Mutation 'R5672:A4gnt'
ID 442681
Institutional Source Beutler Lab
Gene Symbol A4gnt
Ensembl Gene ENSMUSG00000037953
Gene Name alpha-1,4-N-acetylglucosaminyltransferase
Synonyms alpha4GnT, LOC333424
MMRRC Submission 043174-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R5672 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 99612502-99622367 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99620330 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 181 (N181S)
Ref Sequence ENSEMBL: ENSMUSP00000045629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042553]
AlphaFold Q14BT6
Predicted Effect possibly damaging
Transcript: ENSMUST00000042553
AA Change: N181S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045629
Gene: ENSMUSG00000037953
AA Change: N181S

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:Gly_transf_sug 65 188 4e-26 PFAM
Pfam:Gb3_synth 197 324 2.5e-49 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein from the glycosyltransferase 32 family. The encoded enzyme catalyzes the transfer of N-acetylglucosamine to alpha-1,4-linked beta-galactose residues. This enzyme is required for type III mucin synthesis and it is largely associated with the Golgi apparatus membrane. The encoded protein appears to be expressed in adenocarcinoma cells of pancreatic, biliary tract and gastric cancers.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit gastric adenocarcinoma with increased cell proliferation, angiogenesis, inflammation and gastric mucosal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,763,927 T67A probably benign Het
Abcf3 A T 16: 20,549,252 Q74L probably benign Het
Ankrd13c T C 3: 157,961,027 probably null Het
Bub1 A G 2: 127,804,880 F827L possibly damaging Het
Cyp2c55 A G 19: 39,035,546 I355V probably benign Het
Dido1 A G 2: 180,671,903 S319P probably damaging Het
Efna5 A T 17: 62,881,030 V34D probably damaging Het
Fam131a G T 16: 20,699,639 E88D probably damaging Het
Fsip2 A T 2: 82,987,494 R4524* probably null Het
Gm6899 C T 11: 26,593,484 probably benign Het
Iqcg C T 16: 33,019,508 R356Q probably damaging Het
Itgae T A 11: 73,145,551 I1105N possibly damaging Het
Klb T C 5: 65,379,949 I874T possibly damaging Het
Klc3 T C 7: 19,396,331 Y307C probably damaging Het
Lrp1b T A 2: 41,341,759 H378L probably benign Het
Mxd4 G A 5: 34,177,700 R114C probably damaging Het
Nrd1 A T 4: 109,038,045 R241* probably null Het
Ofcc1 G A 13: 40,280,429 H67Y probably damaging Het
Olfr1331 A G 4: 118,869,182 T134A possibly damaging Het
Olfr467 A G 7: 107,814,637 T18A probably damaging Het
Olfr58 T A 9: 19,783,211 I26N possibly damaging Het
Pard3b G T 1: 62,010,466 A128S probably benign Het
Plat T C 8: 22,773,648 Y188H probably benign Het
Pop1 A G 15: 34,530,179 K908E possibly damaging Het
Pten A G 19: 32,758,466 I8V probably benign Het
Pwwp2a C T 11: 43,706,141 A436V probably damaging Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sdk1 T C 5: 142,188,145 C2023R possibly damaging Het
Serpina1d A C 12: 103,763,842 D360E possibly damaging Het
Serpinb9b A G 13: 33,039,599 D258G probably benign Het
Smgc G A 15: 91,841,905 S18N possibly damaging Het
Snx27 A T 3: 94,502,850 probably null Het
Spem1 T G 11: 69,821,437 K134Q probably damaging Het
Srgap3 T A 6: 112,775,561 M321L probably benign Het
Tanc1 T C 2: 59,772,353 C163R possibly damaging Het
Ube2ql1 A T 13: 69,739,327 L5H unknown Het
Ubn2 T C 6: 38,461,527 I225T probably damaging Het
Vmn1r181 A C 7: 23,984,316 T69P probably damaging Het
Vmn2r110 A G 17: 20,596,232 F10L probably benign Het
Yeats2 T C 16: 20,162,029 M236T probably damaging Het
Other mutations in A4gnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:A4gnt APN 9 99620436 nonsense probably null
IGL01509:A4gnt APN 9 99613766 missense probably benign 0.01
IGL02335:A4gnt APN 9 99620213 missense probably benign
IGL03339:A4gnt APN 9 99620548 missense probably damaging 1.00
PIT4466001:A4gnt UTSW 9 99620560 missense probably damaging 0.99
PIT4472001:A4gnt UTSW 9 99620560 missense probably damaging 0.99
R2027:A4gnt UTSW 9 99620201 missense possibly damaging 0.50
R2061:A4gnt UTSW 9 99620359 missense probably damaging 1.00
R4130:A4gnt UTSW 9 99620618 missense possibly damaging 0.81
R4131:A4gnt UTSW 9 99620618 missense possibly damaging 0.81
R5249:A4gnt UTSW 9 99620231 missense probably damaging 0.99
R5338:A4gnt UTSW 9 99620544 missense probably damaging 1.00
R5785:A4gnt UTSW 9 99620672 missense probably damaging 1.00
R6519:A4gnt UTSW 9 99613670 missense probably damaging 1.00
R6630:A4gnt UTSW 9 99613918 missense probably benign 0.00
R7296:A4gnt UTSW 9 99620282 missense probably damaging 0.97
R7514:A4gnt UTSW 9 99620545 missense probably benign 0.05
R7731:A4gnt UTSW 9 99620417 missense possibly damaging 0.63
R9311:A4gnt UTSW 9 99613763 missense possibly damaging 0.82
R9786:A4gnt UTSW 9 99620483 missense possibly damaging 0.65
Z1088:A4gnt UTSW 9 99613841 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCCTTCATGCTTGGAGACC -3'
(R):5'- TCCACTGTGGATAAGGGATGGG -3'

Sequencing Primer
(F):5'- CATGCTTGGAGACCCATTTG -3'
(R):5'- TTCAGGTCACCCAACCCGTG -3'
Posted On 2016-11-09