Incidental Mutation 'R5672:Pop1'
ID 442691
Institutional Source Beutler Lab
Gene Symbol Pop1
Ensembl Gene ENSMUSG00000022325
Gene Name processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae)
Synonyms 4932434G09Rik
MMRRC Submission 043174-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock # R5672 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 34495304-34530648 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34530179 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 908 (K908E)
Ref Sequence ENSEMBL: ENSMUSP00000078037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052290] [ENSMUST00000079028]
AlphaFold Q8K205
Predicted Effect possibly damaging
Transcript: ENSMUST00000052290
AA Change: K938E

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052654
Gene: ENSMUSG00000022325
AA Change: K938E

DomainStartEndE-ValueType
Pfam:POP1 107 190 6.2e-21 PFAM
Pfam:POP1 179 257 2.5e-23 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 647 738 1.4e-30 PFAM
low complexity region 931 940 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079028
AA Change: K908E

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000078037
Gene: ENSMUSG00000022325
AA Change: K908E

DomainStartEndE-ValueType
Pfam:POP1 107 258 1e-46 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 617 708 1.2e-34 PFAM
low complexity region 901 910 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226504
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the protein subunit of two different small nucleolar ribonucleoprotein complexes: the endoribonuclease for mitochondrial RNA processing complex and the ribonuclease P complex. The encoded protein is a ribonuclease that localizes to the nucleus and functions in pre-RNA processing. This protein is also an autoantigen in patients suffering from connective tissue diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,763,927 T67A probably benign Het
A4gnt A G 9: 99,620,330 N181S possibly damaging Het
Abcf3 A T 16: 20,549,252 Q74L probably benign Het
Ankrd13c T C 3: 157,961,027 probably null Het
Bub1 A G 2: 127,804,880 F827L possibly damaging Het
Cyp2c55 A G 19: 39,035,546 I355V probably benign Het
Dido1 A G 2: 180,671,903 S319P probably damaging Het
Efna5 A T 17: 62,881,030 V34D probably damaging Het
Fam131a G T 16: 20,699,639 E88D probably damaging Het
Fsip2 A T 2: 82,987,494 R4524* probably null Het
Gm6899 C T 11: 26,593,484 probably benign Het
Iqcg C T 16: 33,019,508 R356Q probably damaging Het
Itgae T A 11: 73,145,551 I1105N possibly damaging Het
Klb T C 5: 65,379,949 I874T possibly damaging Het
Klc3 T C 7: 19,396,331 Y307C probably damaging Het
Lrp1b T A 2: 41,341,759 H378L probably benign Het
Mxd4 G A 5: 34,177,700 R114C probably damaging Het
Nrd1 A T 4: 109,038,045 R241* probably null Het
Ofcc1 G A 13: 40,280,429 H67Y probably damaging Het
Olfr1331 A G 4: 118,869,182 T134A possibly damaging Het
Olfr467 A G 7: 107,814,637 T18A probably damaging Het
Olfr58 T A 9: 19,783,211 I26N possibly damaging Het
Pard3b G T 1: 62,010,466 A128S probably benign Het
Plat T C 8: 22,773,648 Y188H probably benign Het
Pten A G 19: 32,758,466 I8V probably benign Het
Pwwp2a C T 11: 43,706,141 A436V probably damaging Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sdk1 T C 5: 142,188,145 C2023R possibly damaging Het
Serpina1d A C 12: 103,763,842 D360E possibly damaging Het
Serpinb9b A G 13: 33,039,599 D258G probably benign Het
Smgc G A 15: 91,841,905 S18N possibly damaging Het
Snx27 A T 3: 94,502,850 probably null Het
Spem1 T G 11: 69,821,437 K134Q probably damaging Het
Srgap3 T A 6: 112,775,561 M321L probably benign Het
Tanc1 T C 2: 59,772,353 C163R possibly damaging Het
Ube2ql1 A T 13: 69,739,327 L5H unknown Het
Ubn2 T C 6: 38,461,527 I225T probably damaging Het
Vmn1r181 A C 7: 23,984,316 T69P probably damaging Het
Vmn2r110 A G 17: 20,596,232 F10L probably benign Het
Yeats2 T C 16: 20,162,029 M236T probably damaging Het
Other mutations in Pop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Pop1 APN 15 34508729 missense probably benign 0.00
IGL02192:Pop1 APN 15 34529071 missense probably benign 0.08
IGL02680:Pop1 APN 15 34502473 missense probably damaging 0.99
IGL02958:Pop1 APN 15 34530363 missense probably damaging 0.99
H8562:Pop1 UTSW 15 34530212 missense probably benign 0.00
PIT4802001:Pop1 UTSW 15 34529083 missense probably benign 0.00
R0244:Pop1 UTSW 15 34515891 nonsense probably null
R0281:Pop1 UTSW 15 34529858 splice site probably null
R0453:Pop1 UTSW 15 34526206 missense possibly damaging 0.82
R0579:Pop1 UTSW 15 34509969 missense possibly damaging 0.68
R1054:Pop1 UTSW 15 34509809 missense probably benign 0.30
R1501:Pop1 UTSW 15 34510357 missense probably benign 0.01
R1614:Pop1 UTSW 15 34530210 missense possibly damaging 0.46
R1994:Pop1 UTSW 15 34530471 missense probably damaging 1.00
R2084:Pop1 UTSW 15 34508598 splice site probably benign
R4020:Pop1 UTSW 15 34508780 missense probably benign 0.01
R4550:Pop1 UTSW 15 34528936 missense probably damaging 1.00
R4579:Pop1 UTSW 15 34515824 intron probably benign
R6139:Pop1 UTSW 15 34529058 missense probably benign 0.26
R6161:Pop1 UTSW 15 34526310 missense probably damaging 1.00
R6821:Pop1 UTSW 15 34508639 missense possibly damaging 0.86
R7053:Pop1 UTSW 15 34530275 missense probably benign 0.01
R7195:Pop1 UTSW 15 34510379 missense probably damaging 0.97
R7543:Pop1 UTSW 15 34530447 missense probably damaging 1.00
R7571:Pop1 UTSW 15 34528947 missense probably null 1.00
R7587:Pop1 UTSW 15 34502413 missense probably damaging 0.97
R8401:Pop1 UTSW 15 34508609 missense probably damaging 1.00
R8406:Pop1 UTSW 15 34529170 missense probably benign
R8707:Pop1 UTSW 15 34529203 missense probably benign 0.02
R9044:Pop1 UTSW 15 34530408 missense possibly damaging 0.94
R9066:Pop1 UTSW 15 34515914 missense possibly damaging 0.68
R9236:Pop1 UTSW 15 34499412 missense probably damaging 0.98
RF001:Pop1 UTSW 15 34502437 missense probably damaging 1.00
RF002:Pop1 UTSW 15 34502437 missense probably damaging 1.00
Z1088:Pop1 UTSW 15 34499319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAATGACTTCCCCAGAGCC -3'
(R):5'- TAAGGCTTCTCCACAGCCAG -3'

Sequencing Primer
(F):5'- CCCTGGTGTGGGTCAGC -3'
(R):5'- GCAGCCATAGAAAAATCTCCCTGTG -3'
Posted On 2016-11-09