Incidental Mutation 'R5672:Smgc'
ID442692
Institutional Source Beutler Lab
Gene Symbol Smgc
Ensembl Gene ENSMUSG00000047295
Gene Namesubmandibular gland protein C
SynonymsSfc21, DXImx49e, 2310010P21Rik
MMRRC Submission 043174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5672 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location91838265-91861438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91841905 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 18 (S18N)
Ref Sequence ENSEMBL: ENSMUSP00000118530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088555] [ENSMUST00000100293] [ENSMUST00000109276] [ENSMUST00000109277] [ENSMUST00000126508] [ENSMUST00000130014]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088555
AA Change: S64N

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000085915
Gene: ENSMUSG00000047295
AA Change: S64N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
internal_repeat_1 55 224 2.76e-22 PROSPERO
low complexity region 225 235 N/A INTRINSIC
low complexity region 256 270 N/A INTRINSIC
internal_repeat_1 294 464 2.76e-22 PROSPERO
low complexity region 563 574 N/A INTRINSIC
low complexity region 609 626 N/A INTRINSIC
low complexity region 652 667 N/A INTRINSIC
low complexity region 677 701 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100293
AA Change: S64N

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097866
Gene: ENSMUSG00000047295
AA Change: S64N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
internal_repeat_2 32 180 5.58e-9 PROSPERO
internal_repeat_1 55 224 1.24e-22 PROSPERO
low complexity region 225 235 N/A INTRINSIC
low complexity region 256 270 N/A INTRINSIC
internal_repeat_1 294 464 1.24e-22 PROSPERO
internal_repeat_2 420 569 5.58e-9 PROSPERO
low complexity region 576 593 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 644 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109276
SMART Domains Protein: ENSMUSP00000104899
Gene: ENSMUSG00000047295

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 76 91 N/A INTRINSIC
low complexity region 101 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109277
SMART Domains Protein: ENSMUSP00000104900
Gene: ENSMUSG00000047295

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
low complexity region 72 96 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123935
Predicted Effect possibly damaging
Transcript: ENSMUST00000126508
AA Change: S20N

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120826
Gene: ENSMUSG00000047295
AA Change: S20N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130014
AA Change: S18N

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118530
Gene: ENSMUSG00000047295
AA Change: S18N

DomainStartEndE-ValueType
internal_repeat_1 113 156 5.82e-16 PROSPERO
low complexity region 179 189 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
internal_repeat_1 233 276 5.82e-16 PROSPERO
low complexity region 304 319 N/A INTRINSIC
low complexity region 329 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136172
SMART Domains Protein: ENSMUSP00000119575
Gene: ENSMUSG00000047295

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
low complexity region 155 166 N/A INTRINSIC
low complexity region 201 218 N/A INTRINSIC
low complexity region 244 259 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160242
SMART Domains Protein: ENSMUSP00000125205
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 21 34 N/A INTRINSIC
VWD 47 198 1.31e-13 SMART
Pfam:C8 221 293 1.1e-8 PFAM
Pfam:TIL 298 353 1.6e-11 PFAM
VWD 383 545 1.58e-25 SMART
C8 577 651 8.71e-20 SMART
Pfam:TIL 654 711 2.1e-7 PFAM
Pfam:TIL 753 813 5.2e-8 PFAM
VWD 842 1005 2.36e-47 SMART
C8 1041 1115 1.84e-27 SMART
low complexity region 1220 1254 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,763,927 T67A probably benign Het
A4gnt A G 9: 99,620,330 N181S possibly damaging Het
Abcf3 A T 16: 20,549,252 Q74L probably benign Het
Ankrd13c T C 3: 157,961,027 probably null Het
Bub1 A G 2: 127,804,880 F827L possibly damaging Het
Cyp2c55 A G 19: 39,035,546 I355V probably benign Het
Dido1 A G 2: 180,671,903 S319P probably damaging Het
Efna5 A T 17: 62,881,030 V34D probably damaging Het
Fam131a G T 16: 20,699,639 E88D probably damaging Het
Fsip2 A T 2: 82,987,494 R4524* probably null Het
Gm6899 C T 11: 26,593,484 probably benign Het
Iqcg C T 16: 33,019,508 R356Q probably damaging Het
Itgae T A 11: 73,145,551 I1105N possibly damaging Het
Klb T C 5: 65,379,949 I874T possibly damaging Het
Klc3 T C 7: 19,396,331 Y307C probably damaging Het
Lrp1b T A 2: 41,341,759 H378L probably benign Het
Mxd4 G A 5: 34,177,700 R114C probably damaging Het
Nrd1 A T 4: 109,038,045 R241* probably null Het
Ofcc1 G A 13: 40,280,429 H67Y probably damaging Het
Olfr1331 A G 4: 118,869,182 T134A possibly damaging Het
Olfr467 A G 7: 107,814,637 T18A probably damaging Het
Olfr58 T A 9: 19,783,211 I26N possibly damaging Het
Pard3b G T 1: 62,010,466 A128S probably benign Het
Plat T C 8: 22,773,648 Y188H probably benign Het
Pop1 A G 15: 34,530,179 K908E possibly damaging Het
Pten A G 19: 32,758,466 I8V probably benign Het
Pwwp2a C T 11: 43,706,141 A436V probably damaging Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sdk1 T C 5: 142,188,145 C2023R possibly damaging Het
Serpina1d A C 12: 103,763,842 D360E possibly damaging Het
Serpinb9b A G 13: 33,039,599 D258G probably benign Het
Snx27 A T 3: 94,502,850 probably null Het
Spem1 T G 11: 69,821,437 K134Q probably damaging Het
Srgap3 T A 6: 112,775,561 M321L probably benign Het
Tanc1 T C 2: 59,772,353 C163R possibly damaging Het
Ube2ql1 A T 13: 69,739,327 L5H unknown Het
Ubn2 T C 6: 38,461,527 I225T probably damaging Het
Vmn1r181 A C 7: 23,984,316 T69P probably damaging Het
Vmn2r110 A G 17: 20,596,232 F10L probably benign Het
Yeats2 T C 16: 20,162,029 M236T probably damaging Het
Other mutations in Smgc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Smgc APN 15 91854543 splice site probably benign
IGL00835:Smgc APN 15 91844420 missense probably damaging 0.99
IGL01651:Smgc APN 15 91859788 intron probably benign
IGL01669:Smgc APN 15 91860684 missense possibly damaging 0.89
IGL01743:Smgc APN 15 91854593 missense probably benign 0.19
IGL01898:Smgc APN 15 91844524 splice site probably null
IGL03152:Smgc APN 15 91841422 missense possibly damaging 0.66
IGL03172:Smgc APN 15 91860444 missense probably damaging 0.99
IGL03352:Smgc APN 15 91860678 missense probably damaging 0.96
IGL03385:Smgc APN 15 91841978 missense possibly damaging 0.66
K7371:Smgc UTSW 15 91860255 splice site probably benign
R0090:Smgc UTSW 15 91859762 missense possibly damaging 0.91
R0125:Smgc UTSW 15 91854543 splice site probably benign
R0386:Smgc UTSW 15 91854638 missense probably benign 0.07
R0684:Smgc UTSW 15 91841467 unclassified probably benign
R1187:Smgc UTSW 15 91860600 missense probably damaging 0.99
R1586:Smgc UTSW 15 91838393 missense possibly damaging 0.90
R1848:Smgc UTSW 15 91859758 missense possibly damaging 0.58
R1964:Smgc UTSW 15 91860270 missense probably damaging 1.00
R2144:Smgc UTSW 15 91844421 missense possibly damaging 0.81
R3499:Smgc UTSW 15 91842003 missense possibly damaging 0.66
R3842:Smgc UTSW 15 91860262 splice site probably benign
R3978:Smgc UTSW 15 91860348 missense probably damaging 0.99
R4173:Smgc UTSW 15 91860561 missense possibly damaging 0.95
R4692:Smgc UTSW 15 91854561 missense possibly damaging 0.46
R4761:Smgc UTSW 15 91845514 missense possibly damaging 0.66
R4794:Smgc UTSW 15 91841454 missense probably benign 0.27
R4801:Smgc UTSW 15 91854616 missense probably benign 0.01
R4802:Smgc UTSW 15 91854616 missense probably benign 0.01
R5621:Smgc UTSW 15 91844420 missense probably damaging 0.99
R5707:Smgc UTSW 15 91860663 missense possibly damaging 0.66
R5722:Smgc UTSW 15 91841906 missense possibly damaging 0.83
R6212:Smgc UTSW 15 91850627 intron probably benign
R6767:Smgc UTSW 15 91841398 missense possibly damaging 0.46
R7049:Smgc UTSW 15 91860378 missense possibly damaging 0.82
R7155:Smgc UTSW 15 91852608 missense possibly damaging 0.66
R7210:Smgc UTSW 15 91860294 missense probably damaging 0.99
R7448:Smgc UTSW 15 91845493 missense probably benign 0.02
R7474:Smgc UTSW 15 91860694 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GAAGAAAGGTTCTGATGTTGGC -3'
(R):5'- AAGAGTCCCGGTAGAATACCTC -3'

Sequencing Primer
(F):5'- GGCTTTGGAATTTATAGCTTGAATTC -3'
(R):5'- GTAGAATACCTCCTACTCTGGGCAG -3'
Posted On2016-11-09