Incidental Mutation 'R5673:Mptx2'
ID442703
Institutional Source Beutler Lab
Gene Symbol Mptx2
Ensembl Gene ENSMUSG00000079180
Gene Namemucosal pentraxin 2
SynonymsGm11062
MMRRC Submission 043175-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5673 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173274382-173277777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 173274847 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 92 (L92F)
Ref Sequence ENSEMBL: ENSMUSP00000106855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059754] [ENSMUST00000111224] [ENSMUST00000213420]
Predicted Effect probably benign
Transcript: ENSMUST00000059754
SMART Domains Protein: ENSMUSP00000052418
Gene: ENSMUSG00000049605

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.6e-55 PFAM
Pfam:7tm_1 41 289 5.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111224
AA Change: L92F

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106855
Gene: ENSMUSG00000079180
AA Change: L92F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PTX 20 219 1.93e-94 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213420
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,327,993 Q846* probably null Het
Abhd18 T A 3: 40,923,451 M94K probably damaging Het
Adam2 A G 14: 66,069,232 Y103H probably benign Het
Adamts17 T C 7: 67,041,807 C580R probably damaging Het
Aqp5 G A 15: 99,594,165 V98I probably benign Het
Brd2 A G 17: 34,112,607 probably benign Het
Cd177 T C 7: 24,750,362 N566S probably damaging Het
Cdh23 C T 10: 60,307,857 D2992N probably damaging Het
Cfap69 T C 5: 5,596,027 T140A possibly damaging Het
Cfi A G 3: 129,855,009 I181V probably benign Het
Cnksr1 A G 4: 134,235,188 L133P probably damaging Het
Col1a2 C T 6: 4,539,622 L1297F unknown Het
Crot T C 5: 8,988,131 N132S probably benign Het
Dnah3 T A 7: 119,951,589 Q3169L possibly damaging Het
Dnah8 T A 17: 30,803,261 M3945K probably damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam204a T C 19: 60,199,983 K216E probably damaging Het
Far2 A T 6: 148,146,104 S94C possibly damaging Het
Gm14226 T A 2: 155,024,922 S266R possibly damaging Het
Gpr137 A G 19: 6,939,098 F276L probably damaging Het
Lhx3 T C 2: 26,202,994 Y148C probably damaging Het
Lrfn2 T C 17: 49,096,597 S583P probably benign Het
Lrrc40 A G 3: 158,048,398 probably null Het
Mast4 A T 13: 102,794,072 I224N probably damaging Het
Meis1 T C 11: 19,012,812 K161E probably damaging Het
Mrgprb2 A T 7: 48,552,373 F201L probably benign Het
Mroh1 T A 15: 76,430,181 L686Q probably damaging Het
Mybbp1a G A 11: 72,444,925 V421I probably benign Het
Nadk G A 4: 155,585,185 V143I possibly damaging Het
Nell1 A T 7: 50,228,846 T272S probably damaging Het
Npnt A T 3: 132,917,497 C94S probably damaging Het
Olfml2b T A 1: 170,682,129 V682E probably damaging Het
Pacs2 G A 12: 113,068,998 V655M probably damaging Het
Pcdha1 A C 18: 36,930,673 N130T probably damaging Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sh3pxd2a A G 19: 47,268,666 S566P probably damaging Het
Sirpa T G 2: 129,630,102 V483G probably damaging Het
Sox5 T C 6: 144,116,480 R149G probably damaging Het
Tbc1d4 A G 14: 101,455,008 S1007P probably damaging Het
Tnfrsf8 A G 4: 145,285,335 F317L probably benign Het
Ttn T C 2: 76,717,045 K32219R probably damaging Het
Vmn1r170 A T 7: 23,606,205 T11S possibly damaging Het
Vmn2r65 G T 7: 84,947,407 L147I probably benign Het
Vmn2r77 C T 7: 86,812,006 H847Y probably benign Het
Other mutations in Mptx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Mptx2 APN 1 173274888 missense probably damaging 1.00
IGL01737:Mptx2 APN 1 173274841 missense probably damaging 0.99
IGL02212:Mptx2 APN 1 173274681 missense possibly damaging 0.69
IGL03185:Mptx2 APN 1 173274789 missense possibly damaging 0.68
R1772:Mptx2 UTSW 1 173274473 missense probably damaging 0.98
R2070:Mptx2 UTSW 1 173274578 nonsense probably null
R3792:Mptx2 UTSW 1 173274673 missense probably damaging 1.00
R5700:Mptx2 UTSW 1 173274847 missense probably benign 0.05
R5701:Mptx2 UTSW 1 173274847 missense probably benign 0.05
R6110:Mptx2 UTSW 1 173274847 missense probably benign 0.05
R6118:Mptx2 UTSW 1 173274847 missense probably benign 0.05
R6124:Mptx2 UTSW 1 173274847 missense probably benign 0.05
R6738:Mptx2 UTSW 1 173274855 missense probably benign 0.05
R6895:Mptx2 UTSW 1 173277685 missense probably benign
RF001:Mptx2 UTSW 1 173274969 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAATGATCTTTGCATCACCCC -3'
(R):5'- TCCTCTCCATAGACATGAAGGG -3'

Sequencing Primer
(F):5'- CCCACCACGTATCCCTTCTTCAAG -3'
(R):5'- TCAAGAATCATCCACTGCCTATGTG -3'
Posted On2016-11-09