Incidental Mutation 'R5673:Abhd18'
ID442709
Institutional Source Beutler Lab
Gene Symbol Abhd18
Ensembl Gene ENSMUSG00000037818
Gene Nameabhydrolase domain containing 18
Synonyms3110057O12Rik
MMRRC Submission 043175-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5673 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location40846970-40938138 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40923451 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 94 (M94K)
Ref Sequence ENSEMBL: ENSMUSP00000145006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108077] [ENSMUST00000108078] [ENSMUST00000159774] [ENSMUST00000203650] [ENSMUST00000204496] [ENSMUST00000205065]
Predicted Effect probably damaging
Transcript: ENSMUST00000108077
AA Change: M170K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103712
Gene: ENSMUSG00000037818
AA Change: M170K

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 7.7e-168 PFAM
Pfam:Abhydrolase_6 91 445 1.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108078
AA Change: M170K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103713
Gene: ENSMUSG00000037818
AA Change: M170K

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 7.7e-168 PFAM
Pfam:Abhydrolase_6 91 445 1.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159774
AA Change: M170K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124430
Gene: ENSMUSG00000037818
AA Change: M170K

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 1.3e-171 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203650
AA Change: M94K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145006
Gene: ENSMUSG00000037818
AA Change: M94K

DomainStartEndE-ValueType
Pfam:DUF2048 1 130 8.8e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204496
SMART Domains Protein: ENSMUSP00000145007
Gene: ENSMUSG00000037818

DomainStartEndE-ValueType
Pfam:DUF2048 16 67 2.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204797
Predicted Effect probably benign
Transcript: ENSMUST00000205065
SMART Domains Protein: ENSMUSP00000145095
Gene: ENSMUSG00000037818

DomainStartEndE-ValueType
Pfam:DUF2048 16 151 7.8e-65 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,327,993 Q846* probably null Het
Adam2 A G 14: 66,069,232 Y103H probably benign Het
Adamts17 T C 7: 67,041,807 C580R probably damaging Het
Aqp5 G A 15: 99,594,165 V98I probably benign Het
Brd2 A G 17: 34,112,607 probably benign Het
Cd177 T C 7: 24,750,362 N566S probably damaging Het
Cdh23 C T 10: 60,307,857 D2992N probably damaging Het
Cfap69 T C 5: 5,596,027 T140A possibly damaging Het
Cfi A G 3: 129,855,009 I181V probably benign Het
Cnksr1 A G 4: 134,235,188 L133P probably damaging Het
Col1a2 C T 6: 4,539,622 L1297F unknown Het
Crot T C 5: 8,988,131 N132S probably benign Het
Dnah3 T A 7: 119,951,589 Q3169L possibly damaging Het
Dnah8 T A 17: 30,803,261 M3945K probably damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam204a T C 19: 60,199,983 K216E probably damaging Het
Far2 A T 6: 148,146,104 S94C possibly damaging Het
Gm14226 T A 2: 155,024,922 S266R possibly damaging Het
Gpr137 A G 19: 6,939,098 F276L probably damaging Het
Lhx3 T C 2: 26,202,994 Y148C probably damaging Het
Lrfn2 T C 17: 49,096,597 S583P probably benign Het
Lrrc40 A G 3: 158,048,398 probably null Het
Mast4 A T 13: 102,794,072 I224N probably damaging Het
Meis1 T C 11: 19,012,812 K161E probably damaging Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mrgprb2 A T 7: 48,552,373 F201L probably benign Het
Mroh1 T A 15: 76,430,181 L686Q probably damaging Het
Mybbp1a G A 11: 72,444,925 V421I probably benign Het
Nadk G A 4: 155,585,185 V143I possibly damaging Het
Nell1 A T 7: 50,228,846 T272S probably damaging Het
Npnt A T 3: 132,917,497 C94S probably damaging Het
Olfml2b T A 1: 170,682,129 V682E probably damaging Het
Pacs2 G A 12: 113,068,998 V655M probably damaging Het
Pcdha1 A C 18: 36,930,673 N130T probably damaging Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sh3pxd2a A G 19: 47,268,666 S566P probably damaging Het
Sirpa T G 2: 129,630,102 V483G probably damaging Het
Sox5 T C 6: 144,116,480 R149G probably damaging Het
Tbc1d4 A G 14: 101,455,008 S1007P probably damaging Het
Tnfrsf8 A G 4: 145,285,335 F317L probably benign Het
Ttn T C 2: 76,717,045 K32219R probably damaging Het
Vmn1r170 A T 7: 23,606,205 T11S possibly damaging Het
Vmn2r65 G T 7: 84,947,407 L147I probably benign Het
Vmn2r77 C T 7: 86,812,006 H847Y probably benign Het
Other mutations in Abhd18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Abhd18 APN 3 40933642 missense probably benign 0.00
IGL01785:Abhd18 APN 3 40905904 missense probably damaging 1.00
IGL02318:Abhd18 APN 3 40930227 critical splice donor site probably null
IGL02447:Abhd18 APN 3 40933773 missense probably benign
IGL02823:Abhd18 APN 3 40933518 splice site probably benign
IGL03023:Abhd18 APN 3 40904984 missense probably damaging 0.98
F2404:Abhd18 UTSW 3 40933878 missense probably damaging 0.99
R0064:Abhd18 UTSW 3 40933853 missense probably benign 0.00
R0064:Abhd18 UTSW 3 40933853 missense probably benign 0.00
R0494:Abhd18 UTSW 3 40916688 missense probably damaging 1.00
R1994:Abhd18 UTSW 3 40934926 nonsense probably null
R2206:Abhd18 UTSW 3 40910573 missense probably benign 0.00
R2223:Abhd18 UTSW 3 40934861 splice site probably benign
R2698:Abhd18 UTSW 3 40930966 missense probably benign 0.03
R3406:Abhd18 UTSW 3 40904903 start codon destroyed probably null 1.00
R3747:Abhd18 UTSW 3 40933573 missense probably benign
R4899:Abhd18 UTSW 3 40905869 splice site probably null
R5259:Abhd18 UTSW 3 40916890 missense probably damaging 1.00
R5713:Abhd18 UTSW 3 40934979 nonsense probably null
R5797:Abhd18 UTSW 3 40933551 missense probably benign 0.08
R5983:Abhd18 UTSW 3 40910544 missense probably damaging 1.00
R6333:Abhd18 UTSW 3 40933783 missense probably benign
R6980:Abhd18 UTSW 3 40933780 missense probably benign
R7085:Abhd18 UTSW 3 40916909 missense possibly damaging 0.90
R7091:Abhd18 UTSW 3 40916738 missense probably damaging 0.99
R7096:Abhd18 UTSW 3 40933870 missense probably damaging 1.00
R7168:Abhd18 UTSW 3 40934936 missense probably damaging 1.00
R8027:Abhd18 UTSW 3 40933723 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAGAGGTCCTGAGTTCAATTCC -3'
(R):5'- GGAACTGTCTACTTCCTACTTTGAC -3'

Sequencing Primer
(F):5'- GGTCCTGAGTTCAATTCCAAGCAAC -3'
(R):5'- GACTGACATTAAATTCATGCTTCAAG -3'
Posted On2016-11-09