Incidental Mutation 'R5673:Mrgprb2'
ID442724
Institutional Source Beutler Lab
Gene Symbol Mrgprb2
Ensembl Gene ENSMUSG00000050425
Gene NameMAS-related GPR, member B2
Synonyms4833406I20Rik
MMRRC Submission 043175-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5673 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location48550965-48558086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48552373 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 201 (F201L)
Ref Sequence ENSEMBL: ENSMUSP00000061878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052730]
Predicted Effect probably benign
Transcript: ENSMUST00000052730
AA Change: F201L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000061878
Gene: ENSMUSG00000050425
AA Change: F201L

DomainStartEndE-ValueType
Pfam:7tm_1 54 286 2.1e-7 PFAM
low complexity region 293 308 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired mast cell activation and inflammatory response after 48/80 treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,327,993 Q846* probably null Het
Abhd18 T A 3: 40,923,451 M94K probably damaging Het
Adam2 A G 14: 66,069,232 Y103H probably benign Het
Adamts17 T C 7: 67,041,807 C580R probably damaging Het
Aqp5 G A 15: 99,594,165 V98I probably benign Het
Brd2 A G 17: 34,112,607 probably benign Het
Cd177 T C 7: 24,750,362 N566S probably damaging Het
Cdh23 C T 10: 60,307,857 D2992N probably damaging Het
Cfap69 T C 5: 5,596,027 T140A possibly damaging Het
Cfi A G 3: 129,855,009 I181V probably benign Het
Cnksr1 A G 4: 134,235,188 L133P probably damaging Het
Col1a2 C T 6: 4,539,622 L1297F unknown Het
Crot T C 5: 8,988,131 N132S probably benign Het
Dnah3 T A 7: 119,951,589 Q3169L possibly damaging Het
Dnah8 T A 17: 30,803,261 M3945K probably damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam204a T C 19: 60,199,983 K216E probably damaging Het
Far2 A T 6: 148,146,104 S94C possibly damaging Het
Gm14226 T A 2: 155,024,922 S266R possibly damaging Het
Gpr137 A G 19: 6,939,098 F276L probably damaging Het
Lhx3 T C 2: 26,202,994 Y148C probably damaging Het
Lrfn2 T C 17: 49,096,597 S583P probably benign Het
Lrrc40 A G 3: 158,048,398 probably null Het
Mast4 A T 13: 102,794,072 I224N probably damaging Het
Meis1 T C 11: 19,012,812 K161E probably damaging Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mroh1 T A 15: 76,430,181 L686Q probably damaging Het
Mybbp1a G A 11: 72,444,925 V421I probably benign Het
Nadk G A 4: 155,585,185 V143I possibly damaging Het
Nell1 A T 7: 50,228,846 T272S probably damaging Het
Npnt A T 3: 132,917,497 C94S probably damaging Het
Olfml2b T A 1: 170,682,129 V682E probably damaging Het
Pacs2 G A 12: 113,068,998 V655M probably damaging Het
Pcdha1 A C 18: 36,930,673 N130T probably damaging Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sh3pxd2a A G 19: 47,268,666 S566P probably damaging Het
Sirpa T G 2: 129,630,102 V483G probably damaging Het
Sox5 T C 6: 144,116,480 R149G probably damaging Het
Tbc1d4 A G 14: 101,455,008 S1007P probably damaging Het
Tnfrsf8 A G 4: 145,285,335 F317L probably benign Het
Ttn T C 2: 76,717,045 K32219R probably damaging Het
Vmn1r170 A T 7: 23,606,205 T11S possibly damaging Het
Vmn2r65 G T 7: 84,947,407 L147I probably benign Het
Vmn2r77 C T 7: 86,812,006 H847Y probably benign Het
Other mutations in Mrgprb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Mrgprb2 APN 7 48551998 missense probably benign 0.29
IGL01509:Mrgprb2 APN 7 48552926 missense possibly damaging 0.70
IGL01978:Mrgprb2 APN 7 48552564 missense probably damaging 0.98
IGL02307:Mrgprb2 APN 7 48552896 missense probably benign 0.01
IGL02726:Mrgprb2 APN 7 48552870 missense probably damaging 0.97
IGL03393:Mrgprb2 APN 7 48552902 missense probably benign 0.13
R0190:Mrgprb2 UTSW 7 48552777 missense possibly damaging 0.95
R0334:Mrgprb2 UTSW 7 48552329 missense probably damaging 1.00
R0514:Mrgprb2 UTSW 7 48551970 missense probably benign 0.05
R2177:Mrgprb2 UTSW 7 48552380 missense probably benign 0.11
R2932:Mrgprb2 UTSW 7 48552446 missense probably benign 0.17
R3417:Mrgprb2 UTSW 7 48552533 missense probably damaging 0.98
R3953:Mrgprb2 UTSW 7 48552368 missense possibly damaging 0.78
R5733:Mrgprb2 UTSW 7 48552513 missense probably benign 0.01
R5890:Mrgprb2 UTSW 7 48551959 makesense probably null
R5915:Mrgprb2 UTSW 7 48552806 missense probably benign 0.14
R6147:Mrgprb2 UTSW 7 48552365 missense possibly damaging 0.64
R6381:Mrgprb2 UTSW 7 48552390 missense probably benign 0.01
R6414:Mrgprb2 UTSW 7 48552381 missense probably benign 0.01
R6965:Mrgprb2 UTSW 7 48552849 missense probably damaging 0.97
R7017:Mrgprb2 UTSW 7 48552837 missense probably benign 0.08
R7341:Mrgprb2 UTSW 7 48552896 missense probably benign 0.01
R7399:Mrgprb2 UTSW 7 48552142 missense probably damaging 1.00
Z1177:Mrgprb2 UTSW 7 48552973 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- ATGATGGGGTTCATACAGCTG -3'
(R):5'- GCTGTAAACGTCCAAGACAC -3'

Sequencing Primer
(F):5'- GGGGTTCATACAGCTGTTAACAC -3'
(R):5'- CACACATCAGCTATCACATGTTTTG -3'
Posted On2016-11-09