Incidental Mutation 'R5673:Aqp5'
ID442739
Institutional Source Beutler Lab
Gene Symbol Aqp5
Ensembl Gene ENSMUSG00000044217
Gene Nameaquaporin 5
Synonyms
MMRRC Submission 043175-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5673 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location99590782-99594829 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99594165 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 98 (V98I)
Ref Sequence ENSEMBL: ENSMUSP00000155212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088200] [ENSMUST00000169082] [ENSMUST00000229728] [ENSMUST00000231163]
Predicted Effect probably benign
Transcript: ENSMUST00000088200
AA Change: V215I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085530
Gene: ENSMUSG00000044217
AA Change: V215I

DomainStartEndE-ValueType
Pfam:MIP 4 221 5.8e-75 PFAM
low complexity region 244 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169082
AA Change: V215I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127611
Gene: ENSMUSG00000044217
AA Change: V215I

DomainStartEndE-ValueType
Pfam:MIP 4 221 1.7e-75 PFAM
low complexity region 244 256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229264
Predicted Effect unknown
Transcript: ENSMUST00000229728
AA Change: R213H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230998
Predicted Effect probably benign
Transcript: ENSMUST00000231163
AA Change: V98I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aquaporin 5 (AQP5) is a water channel protein. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0). Aquaporin 5 plays a role in the generation of saliva, tears and pulmonary secretions. AQP0, AQP2, AQP5, and AQP6 are closely related and all map to 12q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit reduced growth on solid food and secrete diminished amounts of hypertonic, viscous saliva. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,327,993 Q846* probably null Het
Abhd18 T A 3: 40,923,451 M94K probably damaging Het
Adam2 A G 14: 66,069,232 Y103H probably benign Het
Adamts17 T C 7: 67,041,807 C580R probably damaging Het
Brd2 A G 17: 34,112,607 probably benign Het
Cd177 T C 7: 24,750,362 N566S probably damaging Het
Cdh23 C T 10: 60,307,857 D2992N probably damaging Het
Cfap69 T C 5: 5,596,027 T140A possibly damaging Het
Cfi A G 3: 129,855,009 I181V probably benign Het
Cnksr1 A G 4: 134,235,188 L133P probably damaging Het
Col1a2 C T 6: 4,539,622 L1297F unknown Het
Crot T C 5: 8,988,131 N132S probably benign Het
Dnah3 T A 7: 119,951,589 Q3169L possibly damaging Het
Dnah8 T A 17: 30,803,261 M3945K probably damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam204a T C 19: 60,199,983 K216E probably damaging Het
Far2 A T 6: 148,146,104 S94C possibly damaging Het
Gm14226 T A 2: 155,024,922 S266R possibly damaging Het
Gpr137 A G 19: 6,939,098 F276L probably damaging Het
Lhx3 T C 2: 26,202,994 Y148C probably damaging Het
Lrfn2 T C 17: 49,096,597 S583P probably benign Het
Lrrc40 A G 3: 158,048,398 probably null Het
Mast4 A T 13: 102,794,072 I224N probably damaging Het
Meis1 T C 11: 19,012,812 K161E probably damaging Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mrgprb2 A T 7: 48,552,373 F201L probably benign Het
Mroh1 T A 15: 76,430,181 L686Q probably damaging Het
Mybbp1a G A 11: 72,444,925 V421I probably benign Het
Nadk G A 4: 155,585,185 V143I possibly damaging Het
Nell1 A T 7: 50,228,846 T272S probably damaging Het
Npnt A T 3: 132,917,497 C94S probably damaging Het
Olfml2b T A 1: 170,682,129 V682E probably damaging Het
Pacs2 G A 12: 113,068,998 V655M probably damaging Het
Pcdha1 A C 18: 36,930,673 N130T probably damaging Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sh3pxd2a A G 19: 47,268,666 S566P probably damaging Het
Sirpa T G 2: 129,630,102 V483G probably damaging Het
Sox5 T C 6: 144,116,480 R149G probably damaging Het
Tbc1d4 A G 14: 101,455,008 S1007P probably damaging Het
Tnfrsf8 A G 4: 145,285,335 F317L probably benign Het
Ttn T C 2: 76,717,045 K32219R probably damaging Het
Vmn1r170 A T 7: 23,606,205 T11S possibly damaging Het
Vmn2r65 G T 7: 84,947,407 L147I probably benign Het
Vmn2r77 C T 7: 86,812,006 H847Y probably benign Het
Other mutations in Aqp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Aqp5 APN 15 99591621 missense probably damaging 1.00
IGL02632:Aqp5 APN 15 99593335 splice site probably benign
R1498:Aqp5 UTSW 15 99593247 missense probably damaging 1.00
R2497:Aqp5 UTSW 15 99591299 missense possibly damaging 0.51
R6542:Aqp5 UTSW 15 99594262 missense probably damaging 0.99
R7059:Aqp5 UTSW 15 99594246 missense probably benign 0.00
R7531:Aqp5 UTSW 15 99591299 missense possibly damaging 0.51
R7635:Aqp5 UTSW 15 99594178 missense probably benign 0.34
R7644:Aqp5 UTSW 15 99594226 missense probably damaging 1.00
R7866:Aqp5 UTSW 15 99591543 missense probably damaging 0.99
R7949:Aqp5 UTSW 15 99591543 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGACACCGTTCCTTCTGGAG -3'
(R):5'- AGAGGTGCTCCAAACTCTTC -3'

Sequencing Primer
(F):5'- AGGCCTGGAGATCTATGCGTC -3'
(R):5'- TTCTCCAGTGGTCCAGGG -3'
Posted On2016-11-09