Mutagenetix > Incidental Mutation

Incidental Mutation 'R5677:Uso1'

442774

Institutional Source

Beutler Lab

Gene Symbol

Uso1

Ensembl Gene

ENSMUSG00000029407

Gene Name

USO1 vesicle docking factor

Synonyms

Vdp, TAP, transcytosis associated protein p115

MMRRC Submission

043316-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5677 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92137938-92202798 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 92201299 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 916 (Q916H)

Ref Sequence

ENSEMBL: ENSMUSP00000031355 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031355] [ENSMUST00000201642] [ENSMUST00000202155]

AlphaFold

Q9Z1Z0

Predicted Effect

probably damaging
Transcript: ENSMUST00000031355
AA Change: Q916H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000031355
Gene: ENSMUSG00000029407
AA Change: Q916H

Domain	Start	End	E-Value	Type
Blast:ARM	47	91	1e-18	BLAST
low complexity region	94	100	N/A	INTRINSIC
Blast:ARM	155	195	2e-15	BLAST
Blast:ARM	300	342	3e-19	BLAST
Pfam:Uso1_p115_head	344	628	6.5e-72	PFAM
low complexity region	630	643	N/A	INTRINSIC
low complexity region	661	672	N/A	INTRINSIC
low complexity region	730	744	N/A	INTRINSIC
Pfam:Uso1_p115_C	782	954	1.6e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201642

SMART Domains

Protein: ENSMUSP00000144165
Gene: ENSMUSG00000029407

Domain	Start	End	E-Value	Type
PDB:3GRL\|A	1	52	5e-24	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000202155
AA Change: Q854H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000144592
Gene: ENSMUSG00000029407
AA Change: Q854H

Domain	Start	End	E-Value	Type
Blast:ARM	47	91	1e-18	BLAST
low complexity region	94	100	N/A	INTRINSIC
Blast:ARM	155	195	2e-15	BLAST
Blast:ARM	300	342	3e-19	BLAST
Pfam:Uso1_p115_head	344	628	5.7e-72	PFAM
low complexity region	630	643	N/A	INTRINSIC
low complexity region	661	672	N/A	INTRINSIC
Pfam:Uso1_p115_C	730	892	2.1e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202362

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein which recycles between the cytosol and the Golgi apparatus during interphase. It is regulated by phosphorylation: dephosphorylated protein associates with the Golgi membrane and dissociates from the membrane upon phosphorylation. Ras-associated protein 1 recruits this protein to coat protein complex II (COPII) vesicles during budding from the endoplasmic reticulum, where it interacts with a set of COPII vesicle-associated SNAREs to form a cis-SNARE complex that promotes targeting to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality between E3.5 and E8.5 with disruption of Golgi apparatus in blastocyst cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 116 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	C	T	10: 28,986,229	V22I	probably benign	Het
4930430A15Rik	T	C	2: 111,211,565	T342A	probably benign	Het
4931423N10Rik	T	A	2: 23,212,718	L156Q	probably damaging	Het
Abca8a	A	T	11: 110,038,399	V1296D	possibly damaging	Het
Abca8b	C	T	11: 109,940,861	S1328N	probably damaging	Het
Adcy1	G	A	11: 7,161,914	M926I	probably damaging	Het
Aff4	G	T	11: 53,400,275	M687I	possibly damaging	Het
Agbl2	T	A	2: 90,807,978	Y636N	possibly damaging	Het
Agtr1a	A	T	13: 30,381,584	I211F	probably damaging	Het
Alkbh8	T	G	9: 3,385,147	S480A	possibly damaging	Het
Ankrd13b	A	T	11: 77,477,544	V84E	probably damaging	Het
Ap3b1	C	T	13: 94,528,196	T881I	unknown	Het
Apbb1	A	C	7: 105,559,246	D617E	probably damaging	Het
Apobec4	A	G	1: 152,757,282	R354G	probably benign	Het
BC003331	G	A	1: 150,374,837	L319F	probably damaging	Het
Brdt	T	G	5: 107,348,617	C198W	possibly damaging	Het
Cacna1b	G	T	2: 24,679,358	H851Q	possibly damaging	Het
Car2	G	T	3: 14,898,055	V217F	possibly damaging	Het
Ccdc24	A	C	4: 117,869,880		probably benign	Het
Chodl	C	A	16: 78,941,315	A57E	probably damaging	Het
Clgn	G	T	8: 83,409,538	C185F	probably damaging	Het
Cltc	G	T	11: 86,705,242	N1223K	probably damaging	Het
Cnot10	T	C	9: 114,629,093	N115S	probably damaging	Het
Col12a1	T	C	9: 79,699,321	R607G	probably damaging	Het
Cpd	A	G	11: 76,799,825	V835A	probably benign	Het
Csmd3	G	C	15: 48,622,051	L153V	probably damaging	Het
Ctr9	A	G	7: 111,044,002	H527R	probably benign	Het
Cwc22	G	A	2: 77,929,443	R87W	probably damaging	Het
D930020B18Rik	T	A	10: 121,669,201	N107K	probably benign	Het
Dgkg	C	A	16: 22,570,171	V418L	probably benign	Het
Dhx40	A	G	11: 86,800,963		probably null	Het
Diaph1	A	T	18: 37,855,951	M910K	probably damaging	Het
Diras2	T	A	13: 52,507,675	M199L	possibly damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dock5	T	A	14: 67,777,603	Q1302H	probably benign	Het
Dync1i2	T	C	2: 71,228,623	S90P	probably benign	Het
E2f8	A	T	7: 48,867,195	V812E	probably damaging	Het
Egfem1	C	A	3: 29,690,174	Q521K	probably damaging	Het
Fbxl18	A	T	5: 142,878,720	C699*	probably null	Het
Fgf3	C	T	7: 144,838,783	R26*	probably null	Het
Fpr-rs7	T	G	17: 20,114,103	I42L	probably benign	Het
Gm13101	A	T	4: 143,965,138	D338E	possibly damaging	Het
Gm3159	T	A	14: 4,398,582	M91K	probably damaging	Het
Gprin3	A	G	6: 59,353,892	S477P	possibly damaging	Het
Grm8	A	T	6: 27,761,204		probably null	Het
Hepacam2	A	T	6: 3,466,142	D420E	probably damaging	Het
Hmcn1	A	T	1: 150,609,778	W4358R	probably benign	Het
Ifna6	G	A	4: 88,827,719	A102T	probably benign	Het
Ighv2-2	T	C	12: 113,588,522	Q32R	probably benign	Het
Igkv1-131	T	A	6: 67,766,258	Q47L	possibly damaging	Het
Il16	T	C	7: 83,674,553	E263G	probably damaging	Het
Kansl1	A	T	11: 104,335,148	C981S	probably benign	Het
Lrp1	A	T	10: 127,574,429	F1483I	probably damaging	Het
Ltf	T	C	9: 111,020,912	M1T	probably null	Het
Ly75	C	T	2: 60,299,082	R1653H	probably benign	Het
Macrod2	T	C	2: 142,176,667	F240S	probably damaging	Het
Man1c1	T	C	4: 134,569,060	E433G	probably damaging	Het
Mansc4	A	T	6: 147,081,549	M130K	probably benign	Het
Mccc1	C	T	3: 35,990,048		probably null	Het
Mink1	G	T	11: 70,605,165	R75L	possibly damaging	Het
Mst1	A	G	9: 108,081,286	D65G	probably damaging	Het
Myo9b	C	T	8: 71,343,686	A857V	probably damaging	Het
Ndufa4	A	G	6: 11,900,575	V70A	probably benign	Het
Npat	T	A	9: 53,555,100	S230T	probably benign	Het
Nr1d1	A	G	11: 98,771,308	Y167H	probably damaging	Het
Oca2	A	G	7: 56,414,462	D735G	probably damaging	Het
Olfr13	T	C	6: 43,174,331	V115A	probably benign	Het
Olfr1359	C	T	13: 21,703,223	T74I	probably benign	Het
Olfr1383	A	G	11: 49,523,944	T74A	probably damaging	Het
Olfr835	T	A	9: 19,035,558	I145N	possibly damaging	Het
Otop1	A	G	5: 38,300,163	Y422C	probably damaging	Het
Pde4dip	G	A	3: 97,841,648	R126*	probably null	Het
Pdp2	C	T	8: 104,594,688	P390S	probably damaging	Het
Pds5b	A	T	5: 150,716,461	T14S	possibly damaging	Het
Pfkp	T	C	13: 6,588,595	E580G	probably damaging	Het
Piezo2	A	T	18: 63,117,696	L212Q	possibly damaging	Het
Piezo2	G	C	18: 63,117,697	L444V	probably benign	Het
Pla2g4d	T	A	2: 120,278,948	T207S	possibly damaging	Het
Plk2	C	A	13: 110,399,057	T471K	possibly damaging	Het
Ppp1r3g	G	A	13: 35,969,262	E222K	probably damaging	Het
Prkcg	A	G	7: 3,323,458	D480G	probably damaging	Het
Pxdc1	T	A	13: 34,652,195	T81S	probably benign	Het
Rnf150	A	T	8: 83,003,599	K253*	probably null	Het
Rsg1	C	T	4: 141,219,866	P186L	probably benign	Het
Sae1	T	C	7: 16,370,462		probably null	Het
Scin	C	T	12: 40,063,259	D538N	probably damaging	Het
Serpinb3c	C	A	1: 107,271,803	K329N	probably damaging	Het
Sgo2b	T	A	8: 63,926,974	K941N	possibly damaging	Het
Six1	C	T	12: 73,046,284	S48N	possibly damaging	Het
Slc39a8	G	A	3: 135,884,688	G381R	probably damaging	Het
Slc9b1	A	G	3: 135,357,559	K35E	unknown	Het
Srek1	C	T	13: 103,759,244	A274T	probably damaging	Het
Steap2	A	T	5: 5,677,497	Y279*	probably null	Het
Svil	T	A	18: 5,046,823	L110*	probably null	Het
Syncrip	T	C	9: 88,456,709		probably benign	Het
Tcf20	A	G	15: 82,853,242	I1336T	probably benign	Het
Tecpr1	T	A	5: 144,218,633	K36*	probably null	Het
Tenm2	A	G	11: 36,141,683	V670A	probably damaging	Het
Thbd	G	A	2: 148,407,366	T194I	probably damaging	Het
Tm9sf2	A	T	14: 122,151,962		probably null	Het
Tmtc4	A	T	14: 122,950,499	I225N	probably damaging	Het
Tpp1	C	T	7: 105,747,536	V425M	probably damaging	Het
Trbc2	T	A	6: 41,547,812	Y144*	probably null	Het
Trps1	T	C	15: 50,846,108	D282G	probably damaging	Het
Tsc22d4	T	A	5: 137,747,142	S9R	probably damaging	Het
Upp1	T	A	11: 9,136,025	D287E	probably benign	Het
Uty	T	A	Y: 1,134,902	Y884F	probably damaging	Het
Vmn1r222	T	C	13: 23,232,780	R88G	probably damaging	Het
Vmn1r79	T	C	7: 12,177,001	V270A	possibly damaging	Het
Zbtb22	T	C	17: 33,917,735	S285P	probably benign	Het
Zfp385a	A	G	15: 103,318,065	V82A	probably damaging	Het
Zfp59	T	C	7: 27,854,169	F349L	probably benign	Het
Zfp780b	T	G	7: 27,962,799	H777P	probably benign	Het
Zfp82	T	C	7: 30,057,124	T178A	probably benign	Het
Zfp850	T	C	7: 27,989,088	Y565C	probably damaging	Het
Zfp957	A	G	14: 79,212,767	Y531H	probably damaging	Het

Other mutations in Uso1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01522:Uso1	APN	5	92181419	missense	probably damaging	0.96
IGL01753:Uso1	APN	5	92152918	critical splice donor site	probably null
IGL02311:Uso1	APN	5	92187776	missense	probably benign
IGL02539:Uso1	APN	5	92187773	missense	probably damaging	1.00
IGL02716:Uso1	APN	5	92173935	missense	probably damaging	0.99
IGL03154:Uso1	APN	5	92180618	nonsense	probably null
R0558:Uso1	UTSW	5	92174019	missense	probably benign	0.03
R0570:Uso1	UTSW	5	92199823	missense	probably benign	0.19
R1195:Uso1	UTSW	5	92170747	missense	probably damaging	1.00
R1195:Uso1	UTSW	5	92170747	missense	probably damaging	1.00
R1195:Uso1	UTSW	5	92170747	missense	probably damaging	1.00
R1398:Uso1	UTSW	5	92181468	missense	probably benign	0.16
R1485:Uso1	UTSW	5	92180563	missense	possibly damaging	0.76
R1813:Uso1	UTSW	5	92201133	critical splice acceptor site	probably null
R1873:Uso1	UTSW	5	92192859	splice site	probably benign
R1896:Uso1	UTSW	5	92201133	critical splice acceptor site	probably null
R1899:Uso1	UTSW	5	92201192	missense	probably benign	0.27
R2049:Uso1	UTSW	5	92181936	missense	probably damaging	1.00
R2128:Uso1	UTSW	5	92195370	missense	probably benign
R2411:Uso1	UTSW	5	92158399	splice site	probably benign
R2903:Uso1	UTSW	5	92195435	critical splice donor site	probably null
R5055:Uso1	UTSW	5	92192735	missense	probably benign	0.31
R5155:Uso1	UTSW	5	92167335	critical splice donor site	probably null
R5590:Uso1	UTSW	5	92180608	missense	probably benign	0.05
R5665:Uso1	UTSW	5	92198337	missense	possibly damaging	0.95
R5996:Uso1	UTSW	5	92192730	missense	probably benign	0.00
R6165:Uso1	UTSW	5	92187267	missense	probably damaging	1.00
R6340:Uso1	UTSW	5	92199852	missense	probably benign	0.01
R6701:Uso1	UTSW	5	92166585	missense	probably damaging	1.00
R6860:Uso1	UTSW	5	92195348	missense	probably benign	0.11
R7062:Uso1	UTSW	5	92192740	missense	possibly damaging	0.62
R7133:Uso1	UTSW	5	92158465	missense	probably benign	0.12
R7317:Uso1	UTSW	5	92173992	missense	possibly damaging	0.70
R7527:Uso1	UTSW	5	92199875	missense	possibly damaging	0.58
R7648:Uso1	UTSW	5	92194002	splice site	probably null
R7707:Uso1	UTSW	5	92201936	makesense	probably null
R8009:Uso1	UTSW	5	92166580	missense	probably benign	0.03
R8104:Uso1	UTSW	5	92158421	missense	probably damaging	0.99
R8361:Uso1	UTSW	5	92189262	missense	probably null	0.00
R8519:Uso1	UTSW	5	92195363	missense	probably benign
R9052:Uso1	UTSW	5	92180563	missense	probably damaging	1.00
R9142:Uso1	UTSW	5	92187266	nonsense	probably null
R9221:Uso1	UTSW	5	92187314	missense	probably benign	0.38
R9492:Uso1	UTSW	5	92167332	missense	possibly damaging	0.77
R9642:Uso1	UTSW	5	92138108	missense	probably damaging	1.00
Z1177:Uso1	UTSW	5	92138130	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- ACTGTTAGGGGCTCTAGGAAGTAAG -3'
(R):5'- ACAGCGAGAACTACATGCAG -3'

Sequencing Primer
(F):5'- TTAGGGGCTCTAGGAAGTAAGTACTG -3'
(R):5'- GCGAGAACTACATGCAGATAATAATC -3'

Posted On

2016-11-09