Mutagenetix > Incidental Mutation

Incidental Mutation 'R5677:Grm8'

442782

Institutional Source

Beutler Lab

Gene Symbol

Grm8

Ensembl Gene

ENSMUSG00000024211

Gene Name

glutamate receptor, metabotropic 8

Synonyms

mGluR8, Gprc1h

MMRRC Submission

043316-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5677 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27275119-28135178 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 27761204 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000110979 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090512] [ENSMUST00000115323] [ENSMUST00000115324] [ENSMUST00000131897]

AlphaFold

P47743

Predicted Effect

probably null
Transcript: ENSMUST00000090512

SMART Domains

Protein: ENSMUSP00000087998
Gene: ENSMUSG00000024211

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	9.6e-102	PFAM
Pfam:Peripla_BP_6	141	375	1.3e-9	PFAM
Pfam:NCD3G	512	562	5e-17	PFAM
Pfam:7tm_3	593	841	4.7e-88	PFAM
low complexity region	887	905	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115323

SMART Domains

Protein: ENSMUSP00000110978
Gene: ENSMUSG00000024211

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	3.3e-107	PFAM
Pfam:NCD3G	512	562	9e-14	PFAM
Pfam:7tm_3	595	840	6.8e-58	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000115324

SMART Domains

Protein: ENSMUSP00000110979
Gene: ENSMUSG00000024211

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	2.1e-101	PFAM
Pfam:Peripla_BP_6	141	375	9.2e-10	PFAM
Pfam:NCD3G	512	562	2.8e-16	PFAM
Pfam:7tm_3	593	841	2.4e-87	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131897

SMART Domains

Protein: ENSMUSP00000120394
Gene: ENSMUSG00000024211

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	294	5.8e-66	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overweight and mildly insulin resistant, and display increased anxiety-related responses and reduced exploration in a new environment. Mice homozygous for a different knock-out allele exhibit altered excitatory responses in the dentate gyrus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 116 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	C	T	10: 28,986,229	V22I	probably benign	Het
4930430A15Rik	T	C	2: 111,211,565	T342A	probably benign	Het
4931423N10Rik	T	A	2: 23,212,718	L156Q	probably damaging	Het
Abca8a	A	T	11: 110,038,399	V1296D	possibly damaging	Het
Abca8b	C	T	11: 109,940,861	S1328N	probably damaging	Het
Adcy1	G	A	11: 7,161,914	M926I	probably damaging	Het
Aff4	G	T	11: 53,400,275	M687I	possibly damaging	Het
Agbl2	T	A	2: 90,807,978	Y636N	possibly damaging	Het
Agtr1a	A	T	13: 30,381,584	I211F	probably damaging	Het
Alkbh8	T	G	9: 3,385,147	S480A	possibly damaging	Het
Ankrd13b	A	T	11: 77,477,544	V84E	probably damaging	Het
Ap3b1	C	T	13: 94,528,196	T881I	unknown	Het
Apbb1	A	C	7: 105,559,246	D617E	probably damaging	Het
Apobec4	A	G	1: 152,757,282	R354G	probably benign	Het
BC003331	G	A	1: 150,374,837	L319F	probably damaging	Het
Brdt	T	G	5: 107,348,617	C198W	possibly damaging	Het
Cacna1b	G	T	2: 24,679,358	H851Q	possibly damaging	Het
Car2	G	T	3: 14,898,055	V217F	possibly damaging	Het
Ccdc24	A	C	4: 117,869,880		probably benign	Het
Chodl	C	A	16: 78,941,315	A57E	probably damaging	Het
Clgn	G	T	8: 83,409,538	C185F	probably damaging	Het
Cltc	G	T	11: 86,705,242	N1223K	probably damaging	Het
Cnot10	T	C	9: 114,629,093	N115S	probably damaging	Het
Col12a1	T	C	9: 79,699,321	R607G	probably damaging	Het
Cpd	A	G	11: 76,799,825	V835A	probably benign	Het
Csmd3	G	C	15: 48,622,051	L153V	probably damaging	Het
Ctr9	A	G	7: 111,044,002	H527R	probably benign	Het
Cwc22	G	A	2: 77,929,443	R87W	probably damaging	Het
D930020B18Rik	T	A	10: 121,669,201	N107K	probably benign	Het
Dgkg	C	A	16: 22,570,171	V418L	probably benign	Het
Dhx40	A	G	11: 86,800,963		probably null	Het
Diaph1	A	T	18: 37,855,951	M910K	probably damaging	Het
Diras2	T	A	13: 52,507,675	M199L	possibly damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dock5	T	A	14: 67,777,603	Q1302H	probably benign	Het
Dync1i2	T	C	2: 71,228,623	S90P	probably benign	Het
E2f8	A	T	7: 48,867,195	V812E	probably damaging	Het
Egfem1	C	A	3: 29,690,174	Q521K	probably damaging	Het
Fbxl18	A	T	5: 142,878,720	C699*	probably null	Het
Fgf3	C	T	7: 144,838,783	R26*	probably null	Het
Fpr-rs7	T	G	17: 20,114,103	I42L	probably benign	Het
Gm13101	A	T	4: 143,965,138	D338E	possibly damaging	Het
Gm3159	T	A	14: 4,398,582	M91K	probably damaging	Het
Gprin3	A	G	6: 59,353,892	S477P	possibly damaging	Het
Hepacam2	A	T	6: 3,466,142	D420E	probably damaging	Het
Hmcn1	A	T	1: 150,609,778	W4358R	probably benign	Het
Ifna6	G	A	4: 88,827,719	A102T	probably benign	Het
Ighv2-2	T	C	12: 113,588,522	Q32R	probably benign	Het
Igkv1-131	T	A	6: 67,766,258	Q47L	possibly damaging	Het
Il16	T	C	7: 83,674,553	E263G	probably damaging	Het
Kansl1	A	T	11: 104,335,148	C981S	probably benign	Het
Lrp1	A	T	10: 127,574,429	F1483I	probably damaging	Het
Ltf	T	C	9: 111,020,912	M1T	probably null	Het
Ly75	C	T	2: 60,299,082	R1653H	probably benign	Het
Macrod2	T	C	2: 142,176,667	F240S	probably damaging	Het
Man1c1	T	C	4: 134,569,060	E433G	probably damaging	Het
Mansc4	A	T	6: 147,081,549	M130K	probably benign	Het
Mccc1	C	T	3: 35,990,048		probably null	Het
Mink1	G	T	11: 70,605,165	R75L	possibly damaging	Het
Mst1	A	G	9: 108,081,286	D65G	probably damaging	Het
Myo9b	C	T	8: 71,343,686	A857V	probably damaging	Het
Ndufa4	A	G	6: 11,900,575	V70A	probably benign	Het
Npat	T	A	9: 53,555,100	S230T	probably benign	Het
Nr1d1	A	G	11: 98,771,308	Y167H	probably damaging	Het
Oca2	A	G	7: 56,414,462	D735G	probably damaging	Het
Olfr13	T	C	6: 43,174,331	V115A	probably benign	Het
Olfr1359	C	T	13: 21,703,223	T74I	probably benign	Het
Olfr1383	A	G	11: 49,523,944	T74A	probably damaging	Het
Olfr835	T	A	9: 19,035,558	I145N	possibly damaging	Het
Otop1	A	G	5: 38,300,163	Y422C	probably damaging	Het
Pde4dip	G	A	3: 97,841,648	R126*	probably null	Het
Pdp2	C	T	8: 104,594,688	P390S	probably damaging	Het
Pds5b	A	T	5: 150,716,461	T14S	possibly damaging	Het
Pfkp	T	C	13: 6,588,595	E580G	probably damaging	Het
Piezo2	A	T	18: 63,117,696	L212Q	possibly damaging	Het
Piezo2	G	C	18: 63,117,697	L444V	probably benign	Het
Pla2g4d	T	A	2: 120,278,948	T207S	possibly damaging	Het
Plk2	C	A	13: 110,399,057	T471K	possibly damaging	Het
Ppp1r3g	G	A	13: 35,969,262	E222K	probably damaging	Het
Prkcg	A	G	7: 3,323,458	D480G	probably damaging	Het
Pxdc1	T	A	13: 34,652,195	T81S	probably benign	Het
Rnf150	A	T	8: 83,003,599	K253*	probably null	Het
Rsg1	C	T	4: 141,219,866	P186L	probably benign	Het
Sae1	T	C	7: 16,370,462		probably null	Het
Scin	C	T	12: 40,063,259	D538N	probably damaging	Het
Serpinb3c	C	A	1: 107,271,803	K329N	probably damaging	Het
Sgo2b	T	A	8: 63,926,974	K941N	possibly damaging	Het
Six1	C	T	12: 73,046,284	S48N	possibly damaging	Het
Slc39a8	G	A	3: 135,884,688	G381R	probably damaging	Het
Slc9b1	A	G	3: 135,357,559	K35E	unknown	Het
Srek1	C	T	13: 103,759,244	A274T	probably damaging	Het
Steap2	A	T	5: 5,677,497	Y279*	probably null	Het
Svil	T	A	18: 5,046,823	L110*	probably null	Het
Syncrip	T	C	9: 88,456,709		probably benign	Het
Tcf20	A	G	15: 82,853,242	I1336T	probably benign	Het
Tecpr1	T	A	5: 144,218,633	K36*	probably null	Het
Tenm2	A	G	11: 36,141,683	V670A	probably damaging	Het
Thbd	G	A	2: 148,407,366	T194I	probably damaging	Het
Tm9sf2	A	T	14: 122,151,962		probably null	Het
Tmtc4	A	T	14: 122,950,499	I225N	probably damaging	Het
Tpp1	C	T	7: 105,747,536	V425M	probably damaging	Het
Trbc2	T	A	6: 41,547,812	Y144*	probably null	Het
Trps1	T	C	15: 50,846,108	D282G	probably damaging	Het
Tsc22d4	T	A	5: 137,747,142	S9R	probably damaging	Het
Upp1	T	A	11: 9,136,025	D287E	probably benign	Het
Uso1	A	C	5: 92,201,299	Q916H	probably damaging	Het
Uty	T	A	Y: 1,134,902	Y884F	probably damaging	Het
Vmn1r222	T	C	13: 23,232,780	R88G	probably damaging	Het
Vmn1r79	T	C	7: 12,177,001	V270A	possibly damaging	Het
Zbtb22	T	C	17: 33,917,735	S285P	probably benign	Het
Zfp385a	A	G	15: 103,318,065	V82A	probably damaging	Het
Zfp59	T	C	7: 27,854,169	F349L	probably benign	Het
Zfp780b	T	G	7: 27,962,799	H777P	probably benign	Het
Zfp82	T	C	7: 30,057,124	T178A	probably benign	Het
Zfp850	T	C	7: 27,989,088	Y565C	probably damaging	Het
Zfp957	A	G	14: 79,212,767	Y531H	probably damaging	Het

Other mutations in Grm8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Grm8	APN	6	27363801	missense	probably damaging	1.00
IGL01412:Grm8	APN	6	27762461	missense	probably damaging	1.00
IGL02329:Grm8	APN	6	27363116	missense	probably damaging	1.00
IGL02342:Grm8	APN	6	27363804	missense	probably benign	0.00
IGL02584:Grm8	APN	6	27762439	missense	probably benign	0.35
IGL03040:Grm8	APN	6	28126123	start codon destroyed	probably null	0.01
IGL03112:Grm8	APN	6	27363263	missense	probably damaging	1.00
IGL03139:Grm8	APN	6	27618650	missense	probably damaging	1.00
IGL03287:Grm8	APN	6	27760255	missense	possibly damaging	0.86
R0137:Grm8	UTSW	6	27762390	missense	probably damaging	0.99
R0266:Grm8	UTSW	6	27285896	missense	probably damaging	1.00
R0347:Grm8	UTSW	6	27981222	missense	probably benign	0.37
R0580:Grm8	UTSW	6	27761371	splice site	probably benign
R0698:Grm8	UTSW	6	27363914	missense	probably damaging	1.00
R0833:Grm8	UTSW	6	27363179	missense	probably damaging	1.00
R1301:Grm8	UTSW	6	27981201	missense	possibly damaging	0.94
R1323:Grm8	UTSW	6	28125974	missense	probably damaging	1.00
R1323:Grm8	UTSW	6	28125974	missense	probably damaging	1.00
R1471:Grm8	UTSW	6	27363309	missense	possibly damaging	0.79
R1554:Grm8	UTSW	6	28125853	missense	probably benign	0.01
R1638:Grm8	UTSW	6	28125883	nonsense	probably null
R1763:Grm8	UTSW	6	27285867	missense	possibly damaging	0.79
R1899:Grm8	UTSW	6	28125895	missense	probably damaging	1.00
R1902:Grm8	UTSW	6	27429482	missense	probably damaging	1.00
R1916:Grm8	UTSW	6	27363584	missense	probably benign	0.01
R2257:Grm8	UTSW	6	27760225	missense	probably damaging	0.98
R2351:Grm8	UTSW	6	28126119	missense	possibly damaging	0.66
R2396:Grm8	UTSW	6	27761242	missense	probably damaging	0.98
R3801:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3802:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3803:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3804:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3830:Grm8	UTSW	6	27761229	nonsense	probably null
R3844:Grm8	UTSW	6	27429508	missense	possibly damaging	0.69
R4006:Grm8	UTSW	6	27981230	missense	probably damaging	1.00
R4077:Grm8	UTSW	6	27760209	missense	probably benign	0.01
R4395:Grm8	UTSW	6	27429432	missense	probably damaging	0.98
R4436:Grm8	UTSW	6	27761238	missense	possibly damaging	0.48
R4810:Grm8	UTSW	6	27761296	missense	possibly damaging	0.87
R5357:Grm8	UTSW	6	27762419	missense	probably damaging	1.00
R5983:Grm8	UTSW	6	27760221	missense	probably benign	0.03
R5990:Grm8	UTSW	6	27363624	missense	probably damaging	1.00
R6365:Grm8	UTSW	6	27363227	missense	probably damaging	1.00
R6454:Grm8	UTSW	6	27363776	missense	possibly damaging	0.68
R6713:Grm8	UTSW	6	27363191	missense	probably damaging	1.00
R6960:Grm8	UTSW	6	27981282	missense	probably damaging	0.98
R7194:Grm8	UTSW	6	27618487	missense	probably benign	0.01
R7259:Grm8	UTSW	6	27760176	missense	probably null	0.99
R7305:Grm8	UTSW	6	27761355	missense	possibly damaging	0.51
R7421:Grm8	UTSW	6	27762477	missense	possibly damaging	0.66
R7561:Grm8	UTSW	6	27429525	missense	probably benign	0.44
R7605:Grm8	UTSW	6	27618679	missense	probably damaging	1.00
R7651:Grm8	UTSW	6	27760258	missense	possibly damaging	0.46
R7775:Grm8	UTSW	6	27363672	missense	possibly damaging	0.89
R7778:Grm8	UTSW	6	27363672	missense	possibly damaging	0.89
R7781:Grm8	UTSW	6	27285787	missense	probably benign
R7785:Grm8	UTSW	6	27618637	missense	probably damaging	0.99
R7898:Grm8	UTSW	6	27762423	missense	probably damaging	1.00
R8272:Grm8	UTSW	6	27363282	missense	probably damaging	1.00
R8274:Grm8	UTSW	6	27761336	missense	probably benign	0.31
R8501:Grm8	UTSW	6	27618541	missense	probably damaging	0.98
R8695:Grm8	UTSW	6	28126031	missense	probably benign	0.01
R8824:Grm8	UTSW	6	27761352	missense	probably damaging	1.00
R8869:Grm8	UTSW	6	27363753	missense	probably benign	0.26
R9322:Grm8	UTSW	6	27363729	missense	possibly damaging	0.88
R9337:Grm8	UTSW	6	27761215	missense	probably benign	0.01
R9518:Grm8	UTSW	6	27429470	missense	probably benign	0.01
RF013:Grm8	UTSW	6	27363780	missense	probably damaging	1.00
Z1176:Grm8	UTSW	6	28126027	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- ATGACTACTGTGCTAAAGGTGC -3'
(R):5'- CTTCAGCACTGGTGTTATGATATC -3'

Sequencing Primer
(F):5'- CTACTGTGCTAAAGGTGCATATTTC -3'
(R):5'- ATCCATAATTGTAGTCCCTTCCAAC -3'

Posted On

2016-11-09