Incidental Mutation 'R5677:Grm8'
ID 442782
Institutional Source Beutler Lab
Gene Symbol Grm8
Ensembl Gene ENSMUSG00000024211
Gene Name glutamate receptor, metabotropic 8
Synonyms mGluR8, Gprc1h
MMRRC Submission 043316-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5677 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 27275120-28135094 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 27761203 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090512] [ENSMUST00000115323] [ENSMUST00000115324] [ENSMUST00000131897]
AlphaFold P47743
Predicted Effect probably null
Transcript: ENSMUST00000090512
SMART Domains Protein: ENSMUSP00000087998
Gene: ENSMUSG00000024211

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 9.6e-102 PFAM
Pfam:Peripla_BP_6 141 375 1.3e-9 PFAM
Pfam:NCD3G 512 562 5e-17 PFAM
Pfam:7tm_3 593 841 4.7e-88 PFAM
low complexity region 887 905 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115323
SMART Domains Protein: ENSMUSP00000110978
Gene: ENSMUSG00000024211

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 3.3e-107 PFAM
Pfam:NCD3G 512 562 9e-14 PFAM
Pfam:7tm_3 595 840 6.8e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115324
SMART Domains Protein: ENSMUSP00000110979
Gene: ENSMUSG00000024211

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 2.1e-101 PFAM
Pfam:Peripla_BP_6 141 375 9.2e-10 PFAM
Pfam:NCD3G 512 562 2.8e-16 PFAM
Pfam:7tm_3 593 841 2.4e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131897
SMART Domains Protein: ENSMUSP00000120394
Gene: ENSMUSG00000024211

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 294 5.8e-66 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overweight and mildly insulin resistant, and display increased anxiety-related responses and reduced exploration in a new environment. Mice homozygous for a different knock-out allele exhibit altered excitatory responses in the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik C T 10: 28,862,225 (GRCm39) V22I probably benign Het
Abca8a A T 11: 109,929,225 (GRCm39) V1296D possibly damaging Het
Abca8b C T 11: 109,831,687 (GRCm39) S1328N probably damaging Het
Adcy1 G A 11: 7,111,914 (GRCm39) M926I probably damaging Het
Aff4 G T 11: 53,291,102 (GRCm39) M687I possibly damaging Het
Agbl2 T A 2: 90,638,322 (GRCm39) Y636N possibly damaging Het
Agtr1a A T 13: 30,565,567 (GRCm39) I211F probably damaging Het
Alkbh8 T G 9: 3,385,147 (GRCm39) S480A possibly damaging Het
Ankrd13b A T 11: 77,368,370 (GRCm39) V84E probably damaging Het
Ap3b1 C T 13: 94,664,704 (GRCm39) T881I unknown Het
Apbb1 A C 7: 105,208,453 (GRCm39) D617E probably damaging Het
Apobec4 A G 1: 152,633,033 (GRCm39) R354G probably benign Het
Brdt T G 5: 107,496,483 (GRCm39) C198W possibly damaging Het
Cacna1b G T 2: 24,569,370 (GRCm39) H851Q possibly damaging Het
Car2 G T 3: 14,963,115 (GRCm39) V217F possibly damaging Het
Ccdc24 A C 4: 117,727,077 (GRCm39) probably benign Het
Chodl C A 16: 78,738,203 (GRCm39) A57E probably damaging Het
Clgn G T 8: 84,136,167 (GRCm39) C185F probably damaging Het
Cltc G T 11: 86,596,068 (GRCm39) N1223K probably damaging Het
Cnot10 T C 9: 114,458,161 (GRCm39) N115S probably damaging Het
Col12a1 T C 9: 79,606,603 (GRCm39) R607G probably damaging Het
Cpd A G 11: 76,690,651 (GRCm39) V835A probably benign Het
Cplane2 C T 4: 140,947,177 (GRCm39) P186L probably benign Het
Csmd3 G C 15: 48,485,447 (GRCm39) L153V probably damaging Het
Ctr9 A G 7: 110,643,209 (GRCm39) H527R probably benign Het
Cwc22 G A 2: 77,759,787 (GRCm39) R87W probably damaging Het
D930020B18Rik T A 10: 121,505,106 (GRCm39) N107K probably benign Het
Dgkg C A 16: 22,388,921 (GRCm39) V418L probably benign Het
Dhx40 A G 11: 86,691,789 (GRCm39) probably null Het
Diaph1 A T 18: 37,989,004 (GRCm39) M910K probably damaging Het
Diras2 T A 13: 52,661,711 (GRCm39) M199L possibly damaging Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Dock5 T A 14: 68,015,052 (GRCm39) Q1302H probably benign Het
Dync1i2 T C 2: 71,058,967 (GRCm39) S90P probably benign Het
E2f8 A T 7: 48,516,943 (GRCm39) V812E probably damaging Het
Egfem1 C A 3: 29,744,323 (GRCm39) Q521K probably damaging Het
Fbxl18 A T 5: 142,864,475 (GRCm39) C699* probably null Het
Fgf3 C T 7: 144,392,520 (GRCm39) R26* probably null Het
Fpr-rs7 T G 17: 20,334,365 (GRCm39) I42L probably benign Het
Gm3159 T A 14: 4,398,582 (GRCm38) M91K probably damaging Het
Gprin3 A G 6: 59,330,877 (GRCm39) S477P possibly damaging Het
Hepacam2 A T 6: 3,466,142 (GRCm39) D420E probably damaging Het
Hmcn1 A T 1: 150,485,529 (GRCm39) W4358R probably benign Het
Ifna6 G A 4: 88,745,956 (GRCm39) A102T probably benign Het
Ighv2-2 T C 12: 113,552,142 (GRCm39) Q32R probably benign Het
Igkv1-131 T A 6: 67,743,242 (GRCm39) Q47L possibly damaging Het
Il16 T C 7: 83,323,761 (GRCm39) E263G probably damaging Het
Kansl1 A T 11: 104,225,974 (GRCm39) C981S probably benign Het
Lrp1 A T 10: 127,410,298 (GRCm39) F1483I probably damaging Het
Ltf T C 9: 110,849,980 (GRCm39) M1T probably null Het
Ly75 C T 2: 60,129,426 (GRCm39) R1653H probably benign Het
Macrod2 T C 2: 142,018,587 (GRCm39) F240S probably damaging Het
Man1c1 T C 4: 134,296,371 (GRCm39) E433G probably damaging Het
Mansc4 A T 6: 146,983,047 (GRCm39) M130K probably benign Het
Mccc1 C T 3: 36,044,197 (GRCm39) probably null Het
Mink1 G T 11: 70,495,991 (GRCm39) R75L possibly damaging Het
Mst1 A G 9: 107,958,485 (GRCm39) D65G probably damaging Het
Myo9b C T 8: 71,796,330 (GRCm39) A857V probably damaging Het
Ndufa4 A G 6: 11,900,574 (GRCm39) V70A probably benign Het
Npat T A 9: 53,466,400 (GRCm39) S230T probably benign Het
Nr1d1 A G 11: 98,662,134 (GRCm39) Y167H probably damaging Het
Oca2 A G 7: 56,064,210 (GRCm39) D735G probably damaging Het
Odr4 G A 1: 150,250,588 (GRCm39) L319F probably damaging Het
Or2a7 T C 6: 43,151,265 (GRCm39) V115A probably benign Het
Or2b2 C T 13: 21,887,393 (GRCm39) T74I probably benign Het
Or2y13 A G 11: 49,414,771 (GRCm39) T74A probably damaging Het
Or7g20 T A 9: 18,946,854 (GRCm39) I145N possibly damaging Het
Otop1 A G 5: 38,457,507 (GRCm39) Y422C probably damaging Het
Pde4dip G A 3: 97,748,964 (GRCm39) R126* probably null Het
Pdp2 C T 8: 105,321,320 (GRCm39) P390S probably damaging Het
Pds5b A T 5: 150,639,926 (GRCm39) T14S possibly damaging Het
Pfkp T C 13: 6,638,631 (GRCm39) E580G probably damaging Het
Piezo2 A T 18: 63,250,767 (GRCm39) L212Q possibly damaging Het
Piezo2 G C 18: 63,250,768 (GRCm39) L444V probably benign Het
Pla2g4d T A 2: 120,109,429 (GRCm39) T207S possibly damaging Het
Plk2 C A 13: 110,535,591 (GRCm39) T471K possibly damaging Het
Potefam1 T C 2: 111,041,910 (GRCm39) T342A probably benign Het
Potegl T A 2: 23,102,730 (GRCm39) L156Q probably damaging Het
Ppp1r3g G A 13: 36,153,245 (GRCm39) E222K probably damaging Het
Pramel28 A T 4: 143,691,708 (GRCm39) D338E possibly damaging Het
Prkcg A G 7: 3,371,974 (GRCm39) D480G probably damaging Het
Pxdc1 T A 13: 34,836,178 (GRCm39) T81S probably benign Het
Rnf150 A T 8: 83,730,228 (GRCm39) K253* probably null Het
Sae1 T C 7: 16,104,387 (GRCm39) probably null Het
Scin C T 12: 40,113,258 (GRCm39) D538N probably damaging Het
Serpinb3c C A 1: 107,199,533 (GRCm39) K329N probably damaging Het
Sgo2b T A 8: 64,380,008 (GRCm39) K941N possibly damaging Het
Six1 C T 12: 73,093,058 (GRCm39) S48N possibly damaging Het
Slc39a8 G A 3: 135,590,449 (GRCm39) G381R probably damaging Het
Slc9b1 A G 3: 135,063,320 (GRCm39) K35E unknown Het
Srek1 C T 13: 103,895,752 (GRCm39) A274T probably damaging Het
Steap2 A T 5: 5,727,497 (GRCm39) Y279* probably null Het
Svil T A 18: 5,046,823 (GRCm39) L110* probably null Het
Syncrip T C 9: 88,338,762 (GRCm39) probably benign Het
Tcf20 A G 15: 82,737,443 (GRCm39) I1336T probably benign Het
Tecpr1 T A 5: 144,155,451 (GRCm39) K36* probably null Het
Tenm2 A G 11: 36,032,510 (GRCm39) V670A probably damaging Het
Thbd G A 2: 148,249,286 (GRCm39) T194I probably damaging Het
Tm9sf2 A T 14: 122,389,374 (GRCm39) probably null Het
Tmtc4 A T 14: 123,187,911 (GRCm39) I225N probably damaging Het
Tpp1 C T 7: 105,396,743 (GRCm39) V425M probably damaging Het
Trbc2 T A 6: 41,524,746 (GRCm39) Y144* probably null Het
Trps1 T C 15: 50,709,504 (GRCm39) D282G probably damaging Het
Tsc22d4 T A 5: 137,745,404 (GRCm39) S9R probably damaging Het
Upp1 T A 11: 9,086,025 (GRCm39) D287E probably benign Het
Uso1 A C 5: 92,349,158 (GRCm39) Q916H probably damaging Het
Uty T A Y: 1,134,902 (GRCm39) Y884F probably damaging Het
Vmn1r222 T C 13: 23,416,950 (GRCm39) R88G probably damaging Het
Vmn1r79 T C 7: 11,910,928 (GRCm39) V270A possibly damaging Het
Zbtb22 T C 17: 34,136,709 (GRCm39) S285P probably benign Het
Zfp385a A G 15: 103,226,492 (GRCm39) V82A probably damaging Het
Zfp59 T C 7: 27,553,594 (GRCm39) F349L probably benign Het
Zfp780b T G 7: 27,662,224 (GRCm39) H777P probably benign Het
Zfp82 T C 7: 29,756,549 (GRCm39) T178A probably benign Het
Zfp850 T C 7: 27,688,513 (GRCm39) Y565C probably damaging Het
Zfp957 A G 14: 79,450,207 (GRCm39) Y531H probably damaging Het
Other mutations in Grm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Grm8 APN 6 27,363,800 (GRCm39) missense probably damaging 1.00
IGL01412:Grm8 APN 6 27,762,460 (GRCm39) missense probably damaging 1.00
IGL02329:Grm8 APN 6 27,363,115 (GRCm39) missense probably damaging 1.00
IGL02342:Grm8 APN 6 27,363,803 (GRCm39) missense probably benign 0.00
IGL02584:Grm8 APN 6 27,762,438 (GRCm39) missense probably benign 0.35
IGL03040:Grm8 APN 6 28,126,122 (GRCm39) start codon destroyed probably null 0.01
IGL03112:Grm8 APN 6 27,363,262 (GRCm39) missense probably damaging 1.00
IGL03139:Grm8 APN 6 27,618,649 (GRCm39) missense probably damaging 1.00
IGL03287:Grm8 APN 6 27,760,254 (GRCm39) missense possibly damaging 0.86
R0137:Grm8 UTSW 6 27,762,389 (GRCm39) missense probably damaging 0.99
R0266:Grm8 UTSW 6 27,285,895 (GRCm39) missense probably damaging 1.00
R0347:Grm8 UTSW 6 27,981,221 (GRCm39) missense probably benign 0.37
R0580:Grm8 UTSW 6 27,761,370 (GRCm39) splice site probably benign
R0698:Grm8 UTSW 6 27,363,913 (GRCm39) missense probably damaging 1.00
R0833:Grm8 UTSW 6 27,363,178 (GRCm39) missense probably damaging 1.00
R1301:Grm8 UTSW 6 27,981,200 (GRCm39) missense possibly damaging 0.94
R1323:Grm8 UTSW 6 28,125,973 (GRCm39) missense probably damaging 1.00
R1323:Grm8 UTSW 6 28,125,973 (GRCm39) missense probably damaging 1.00
R1471:Grm8 UTSW 6 27,363,308 (GRCm39) missense possibly damaging 0.79
R1554:Grm8 UTSW 6 28,125,852 (GRCm39) missense probably benign 0.01
R1638:Grm8 UTSW 6 28,125,882 (GRCm39) nonsense probably null
R1763:Grm8 UTSW 6 27,285,866 (GRCm39) missense possibly damaging 0.79
R1899:Grm8 UTSW 6 28,125,894 (GRCm39) missense probably damaging 1.00
R1902:Grm8 UTSW 6 27,429,481 (GRCm39) missense probably damaging 1.00
R1916:Grm8 UTSW 6 27,363,583 (GRCm39) missense probably benign 0.01
R2257:Grm8 UTSW 6 27,760,224 (GRCm39) missense probably damaging 0.98
R2351:Grm8 UTSW 6 28,126,118 (GRCm39) missense possibly damaging 0.66
R2396:Grm8 UTSW 6 27,761,241 (GRCm39) missense probably damaging 0.98
R3801:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3802:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3803:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3804:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3830:Grm8 UTSW 6 27,761,228 (GRCm39) nonsense probably null
R3844:Grm8 UTSW 6 27,429,507 (GRCm39) missense possibly damaging 0.69
R4006:Grm8 UTSW 6 27,981,229 (GRCm39) missense probably damaging 1.00
R4077:Grm8 UTSW 6 27,760,208 (GRCm39) missense probably benign 0.01
R4395:Grm8 UTSW 6 27,429,431 (GRCm39) missense probably damaging 0.98
R4436:Grm8 UTSW 6 27,761,237 (GRCm39) missense possibly damaging 0.48
R4810:Grm8 UTSW 6 27,761,295 (GRCm39) missense possibly damaging 0.87
R5357:Grm8 UTSW 6 27,762,418 (GRCm39) missense probably damaging 1.00
R5983:Grm8 UTSW 6 27,760,220 (GRCm39) missense probably benign 0.03
R5990:Grm8 UTSW 6 27,363,623 (GRCm39) missense probably damaging 1.00
R6365:Grm8 UTSW 6 27,363,226 (GRCm39) missense probably damaging 1.00
R6454:Grm8 UTSW 6 27,363,775 (GRCm39) missense possibly damaging 0.68
R6713:Grm8 UTSW 6 27,363,190 (GRCm39) missense probably damaging 1.00
R6960:Grm8 UTSW 6 27,981,281 (GRCm39) missense probably damaging 0.98
R7194:Grm8 UTSW 6 27,618,486 (GRCm39) missense probably benign 0.01
R7259:Grm8 UTSW 6 27,760,175 (GRCm39) missense probably null 0.99
R7305:Grm8 UTSW 6 27,761,354 (GRCm39) missense possibly damaging 0.51
R7421:Grm8 UTSW 6 27,762,476 (GRCm39) missense possibly damaging 0.66
R7561:Grm8 UTSW 6 27,429,524 (GRCm39) missense probably benign 0.44
R7605:Grm8 UTSW 6 27,618,678 (GRCm39) missense probably damaging 1.00
R7651:Grm8 UTSW 6 27,760,257 (GRCm39) missense possibly damaging 0.46
R7775:Grm8 UTSW 6 27,363,671 (GRCm39) missense possibly damaging 0.89
R7778:Grm8 UTSW 6 27,363,671 (GRCm39) missense possibly damaging 0.89
R7781:Grm8 UTSW 6 27,285,786 (GRCm39) missense probably benign
R7785:Grm8 UTSW 6 27,618,636 (GRCm39) missense probably damaging 0.99
R7898:Grm8 UTSW 6 27,762,422 (GRCm39) missense probably damaging 1.00
R8272:Grm8 UTSW 6 27,363,281 (GRCm39) missense probably damaging 1.00
R8274:Grm8 UTSW 6 27,761,335 (GRCm39) missense probably benign 0.31
R8501:Grm8 UTSW 6 27,618,540 (GRCm39) missense probably damaging 0.98
R8695:Grm8 UTSW 6 28,126,030 (GRCm39) missense probably benign 0.01
R8824:Grm8 UTSW 6 27,761,351 (GRCm39) missense probably damaging 1.00
R8869:Grm8 UTSW 6 27,363,752 (GRCm39) missense probably benign 0.26
R9322:Grm8 UTSW 6 27,363,728 (GRCm39) missense possibly damaging 0.88
R9337:Grm8 UTSW 6 27,761,214 (GRCm39) missense probably benign 0.01
R9518:Grm8 UTSW 6 27,429,469 (GRCm39) missense probably benign 0.01
RF013:Grm8 UTSW 6 27,363,779 (GRCm39) missense probably damaging 1.00
Z1176:Grm8 UTSW 6 28,126,026 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ATGACTACTGTGCTAAAGGTGC -3'
(R):5'- CTTCAGCACTGGTGTTATGATATC -3'

Sequencing Primer
(F):5'- CTACTGTGCTAAAGGTGCATATTTC -3'
(R):5'- ATCCATAATTGTAGTCCCTTCCAAC -3'
Posted On 2016-11-09