Incidental Mutation 'R5677:Apbb1'
ID442798
Institutional Source Beutler Lab
Gene Symbol Apbb1
Ensembl Gene ENSMUSG00000037032
Gene Nameamyloid beta (A4) precursor protein-binding, family B, member 1
SynonymsFe65, Rir
MMRRC Submission 043316-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5677 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105558483-105581653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 105559246 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 617 (D617E)
Ref Sequence ENSEMBL: ENSMUSP00000140116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046983] [ENSMUST00000081165] [ENSMUST00000186814] [ENSMUST00000187057] [ENSMUST00000188001] [ENSMUST00000188368] [ENSMUST00000189072] [ENSMUST00000189265] [ENSMUST00000189378] [ENSMUST00000190369] [ENSMUST00000191011] [ENSMUST00000191601]
Predicted Effect probably benign
Transcript: ENSMUST00000046983
SMART Domains Protein: ENSMUSP00000042187
Gene: ENSMUSG00000037049

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
SapB 85 163 1.05e-7 SMART
low complexity region 177 196 N/A INTRINSIC
Pfam:Metallophos 197 459 4.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081165
AA Change: D617E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079932
Gene: ENSMUSG00000037032
AA Change: D617E

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 4.16e-38 SMART
PTB 538 667 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186814
Predicted Effect probably damaging
Transcript: ENSMUST00000187057
AA Change: D392E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139899
Gene: ENSMUSG00000037032
AA Change: D392E

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 287 3.8e-41 SMART
PTB 313 442 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188001
Predicted Effect probably damaging
Transcript: ENSMUST00000188368
AA Change: D394E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139788
Gene: ENSMUSG00000037032
AA Change: D394E

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 289 1.8e-40 SMART
PTB 315 444 9.5e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189072
AA Change: D358E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139575
Gene: ENSMUSG00000037032
AA Change: D358E

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189265
AA Change: D142E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140137
Gene: ENSMUSG00000037032
AA Change: D142E

DomainStartEndE-ValueType
Pfam:PID 1 34 2.3e-6 PFAM
PTB 63 192 9.5e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189378
AA Change: D615E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140979
Gene: ENSMUSG00000037032
AA Change: D615E

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190369
AA Change: D358E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140486
Gene: ENSMUSG00000037032
AA Change: D358E

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191011
AA Change: D615E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140973
Gene: ENSMUSG00000037032
AA Change: D615E

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191250
Predicted Effect probably damaging
Transcript: ENSMUST00000191601
AA Change: D617E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140116
Gene: ENSMUSG00000037032
AA Change: D617E

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 3.7e-7 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 1.8e-40 SMART
PTB 538 667 9.5e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000211614
AA Change: D136E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211307
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Fe65 protein family. It is an adaptor protein localized in the nucleus. It interacts with the Alzheimer's disease amyloid precursor protein (APP), transcription factor CP2/LSF/LBP1 and the low-density lipoprotein receptor-related protein. APP functions as a cytosolic anchoring site that can prevent the gene product's nuclear translocation. This encoded protein could play an important role in the pathogenesis of Alzheimer's disease. It is thought to regulate transcription. Also it is observed to block cell cycle progression by downregulating thymidylate synthase expression. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for a null allele are hypersensitive to ionizing radiation while mouse embryonic fibroblasts are hypersensitive to DNA damaging agents. Homozygotes for a second null allele display impaired performance in learning and memory tasks, with a striking deficit in reversal spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik C T 10: 28,986,229 V22I probably benign Het
4930430A15Rik T C 2: 111,211,565 T342A probably benign Het
4931423N10Rik T A 2: 23,212,718 L156Q probably damaging Het
Abca8a A T 11: 110,038,399 V1296D possibly damaging Het
Abca8b C T 11: 109,940,861 S1328N probably damaging Het
Adcy1 G A 11: 7,161,914 M926I probably damaging Het
Aff4 G T 11: 53,400,275 M687I possibly damaging Het
Agbl2 T A 2: 90,807,978 Y636N possibly damaging Het
Agtr1a A T 13: 30,381,584 I211F probably damaging Het
Alkbh8 T G 9: 3,385,147 S480A possibly damaging Het
Ankrd13b A T 11: 77,477,544 V84E probably damaging Het
Ap3b1 C T 13: 94,528,196 T881I unknown Het
Apobec4 A G 1: 152,757,282 R354G probably benign Het
BC003331 G A 1: 150,374,837 L319F probably damaging Het
Brdt T G 5: 107,348,617 C198W possibly damaging Het
Cacna1b G T 2: 24,679,358 H851Q possibly damaging Het
Car2 G T 3: 14,898,055 V217F possibly damaging Het
Ccdc24 A C 4: 117,869,880 probably benign Het
Chodl C A 16: 78,941,315 A57E probably damaging Het
Clgn G T 8: 83,409,538 C185F probably damaging Het
Cltc G T 11: 86,705,242 N1223K probably damaging Het
Cnot10 T C 9: 114,629,093 N115S probably damaging Het
Col12a1 T C 9: 79,699,321 R607G probably damaging Het
Cpd A G 11: 76,799,825 V835A probably benign Het
Csmd3 G C 15: 48,622,051 L153V probably damaging Het
Ctr9 A G 7: 111,044,002 H527R probably benign Het
Cwc22 G A 2: 77,929,443 R87W probably damaging Het
D930020B18Rik T A 10: 121,669,201 N107K probably benign Het
Dgkg C A 16: 22,570,171 V418L probably benign Het
Dhx40 A G 11: 86,800,963 probably null Het
Diaph1 A T 18: 37,855,951 M910K probably damaging Het
Diras2 T A 13: 52,507,675 M199L possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock5 T A 14: 67,777,603 Q1302H probably benign Het
Dync1i2 T C 2: 71,228,623 S90P probably benign Het
E2f8 A T 7: 48,867,195 V812E probably damaging Het
Egfem1 C A 3: 29,690,174 Q521K probably damaging Het
Fbxl18 A T 5: 142,878,720 C699* probably null Het
Fgf3 C T 7: 144,838,783 R26* probably null Het
Fpr-rs7 T G 17: 20,114,103 I42L probably benign Het
Gm13101 A T 4: 143,965,138 D338E possibly damaging Het
Gm3159 T A 14: 4,398,582 M91K probably damaging Het
Gprin3 A G 6: 59,353,892 S477P possibly damaging Het
Grm8 A T 6: 27,761,204 probably null Het
Hepacam2 A T 6: 3,466,142 D420E probably damaging Het
Hmcn1 A T 1: 150,609,778 W4358R probably benign Het
Ifna6 G A 4: 88,827,719 A102T probably benign Het
Ighv2-2 T C 12: 113,588,522 Q32R probably benign Het
Igkv1-131 T A 6: 67,766,258 Q47L possibly damaging Het
Il16 T C 7: 83,674,553 E263G probably damaging Het
Kansl1 A T 11: 104,335,148 C981S probably benign Het
Lrp1 A T 10: 127,574,429 F1483I probably damaging Het
Ltf T C 9: 111,020,912 M1T probably null Het
Ly75 C T 2: 60,299,082 R1653H probably benign Het
Macrod2 T C 2: 142,176,667 F240S probably damaging Het
Man1c1 T C 4: 134,569,060 E433G probably damaging Het
Mansc4 A T 6: 147,081,549 M130K probably benign Het
Mccc1 C T 3: 35,990,048 probably null Het
Mink1 G T 11: 70,605,165 R75L possibly damaging Het
Mst1 A G 9: 108,081,286 D65G probably damaging Het
Myo9b C T 8: 71,343,686 A857V probably damaging Het
Ndufa4 A G 6: 11,900,575 V70A probably benign Het
Npat T A 9: 53,555,100 S230T probably benign Het
Nr1d1 A G 11: 98,771,308 Y167H probably damaging Het
Oca2 A G 7: 56,414,462 D735G probably damaging Het
Olfr13 T C 6: 43,174,331 V115A probably benign Het
Olfr1359 C T 13: 21,703,223 T74I probably benign Het
Olfr1383 A G 11: 49,523,944 T74A probably damaging Het
Olfr835 T A 9: 19,035,558 I145N possibly damaging Het
Otop1 A G 5: 38,300,163 Y422C probably damaging Het
Pde4dip G A 3: 97,841,648 R126* probably null Het
Pdp2 C T 8: 104,594,688 P390S probably damaging Het
Pds5b A T 5: 150,716,461 T14S possibly damaging Het
Pfkp T C 13: 6,588,595 E580G probably damaging Het
Piezo2 A T 18: 63,117,696 L212Q possibly damaging Het
Piezo2 G C 18: 63,117,697 L444V probably benign Het
Pla2g4d T A 2: 120,278,948 T207S possibly damaging Het
Plk2 C A 13: 110,399,057 T471K possibly damaging Het
Ppp1r3g G A 13: 35,969,262 E222K probably damaging Het
Prkcg A G 7: 3,323,458 D480G probably damaging Het
Pxdc1 T A 13: 34,652,195 T81S probably benign Het
Rnf150 A T 8: 83,003,599 K253* probably null Het
Rsg1 C T 4: 141,219,866 P186L probably benign Het
Sae1 T C 7: 16,370,462 probably null Het
Scin C T 12: 40,063,259 D538N probably damaging Het
Serpinb3c C A 1: 107,271,803 K329N probably damaging Het
Sgo2b T A 8: 63,926,974 K941N possibly damaging Het
Six1 C T 12: 73,046,284 S48N possibly damaging Het
Slc39a8 G A 3: 135,884,688 G381R probably damaging Het
Slc9b1 A G 3: 135,357,559 K35E unknown Het
Srek1 C T 13: 103,759,244 A274T probably damaging Het
Steap2 A T 5: 5,677,497 Y279* probably null Het
Svil T A 18: 5,046,823 L110* probably null Het
Syncrip T C 9: 88,456,709 probably benign Het
Tcf20 A G 15: 82,853,242 I1336T probably benign Het
Tecpr1 T A 5: 144,218,633 K36* probably null Het
Tenm2 A G 11: 36,141,683 V670A probably damaging Het
Thbd G A 2: 148,407,366 T194I probably damaging Het
Tm9sf2 A T 14: 122,151,962 probably null Het
Tmtc4 A T 14: 122,950,499 I225N probably damaging Het
Tpp1 C T 7: 105,747,536 V425M probably damaging Het
Trbc2 T A 6: 41,547,812 Y144* probably null Het
Trps1 T C 15: 50,846,108 D282G probably damaging Het
Tsc22d4 T A 5: 137,747,142 S9R probably damaging Het
Upp1 T A 11: 9,136,025 D287E probably benign Het
Uso1 A C 5: 92,201,299 Q916H probably damaging Het
Uty T A Y: 1,134,902 Y884F probably damaging Het
Vmn1r222 T C 13: 23,232,780 R88G probably damaging Het
Vmn1r79 T C 7: 12,177,001 V270A possibly damaging Het
Zbtb22 T C 17: 33,917,735 S285P probably benign Het
Zfp385a A G 15: 103,318,065 V82A probably damaging Het
Zfp59 T C 7: 27,854,169 F349L probably benign Het
Zfp780b T G 7: 27,962,799 H777P probably benign Het
Zfp82 T C 7: 30,057,124 T178A probably benign Het
Zfp850 T C 7: 27,989,088 Y565C probably damaging Het
Zfp957 A G 14: 79,212,767 Y531H probably damaging Het
Other mutations in Apbb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02171:Apbb1 APN 7 105559126 splice site probably benign
athena UTSW 7 105566695 missense probably benign
R0092:Apbb1 UTSW 7 105559154 missense probably damaging 1.00
R0348:Apbb1 UTSW 7 105565303 missense probably damaging 0.98
R0633:Apbb1 UTSW 7 105558963 missense probably damaging 1.00
R0946:Apbb1 UTSW 7 105573855 missense probably benign 0.09
R1076:Apbb1 UTSW 7 105573855 missense probably benign 0.09
R1332:Apbb1 UTSW 7 105565543 missense possibly damaging 0.74
R1658:Apbb1 UTSW 7 105574084 missense probably damaging 1.00
R1739:Apbb1 UTSW 7 105574227 missense probably benign
R4230:Apbb1 UTSW 7 105567684 missense probably damaging 1.00
R4296:Apbb1 UTSW 7 105573826 missense probably benign 0.16
R4385:Apbb1 UTSW 7 105567276 missense probably benign 0.00
R4571:Apbb1 UTSW 7 105573762 missense probably damaging 1.00
R4647:Apbb1 UTSW 7 105565538 missense probably benign 0.01
R4812:Apbb1 UTSW 7 105574025 missense probably damaging 0.99
R5044:Apbb1 UTSW 7 105565682 intron probably benign
R5109:Apbb1 UTSW 7 105565035 missense probably damaging 1.00
R5479:Apbb1 UTSW 7 105565025 missense probably damaging 0.97
R5611:Apbb1 UTSW 7 105559483 missense probably damaging 1.00
R5785:Apbb1 UTSW 7 105567715 missense probably damaging 1.00
R5850:Apbb1 UTSW 7 105567583 missense probably damaging 1.00
R5896:Apbb1 UTSW 7 105574225 missense probably damaging 1.00
R6151:Apbb1 UTSW 7 105574252 nonsense probably null
R6186:Apbb1 UTSW 7 105567726 missense probably damaging 1.00
R6229:Apbb1 UTSW 7 105573730 missense probably damaging 0.98
R6229:Apbb1 UTSW 7 105573731 missense probably damaging 0.98
R6288:Apbb1 UTSW 7 105559227 missense probably damaging 1.00
R6295:Apbb1 UTSW 7 105566695 missense probably benign
R6443:Apbb1 UTSW 7 105573763 missense probably damaging 1.00
R6729:Apbb1 UTSW 7 105565381 missense probably damaging 1.00
R7130:Apbb1 UTSW 7 105565331 missense probably damaging 0.98
R7209:Apbb1 UTSW 7 105566085 missense probably damaging 1.00
R7467:Apbb1 UTSW 7 105566132 missense probably benign 0.04
R7489:Apbb1 UTSW 7 105567480 missense probably benign 0.30
R7588:Apbb1 UTSW 7 105573966 missense probably benign 0.29
R7754:Apbb1 UTSW 7 105559302 missense probably damaging 0.97
R7768:Apbb1 UTSW 7 105567088 missense probably benign
R7785:Apbb1 UTSW 7 105567423 missense probably benign 0.00
R7804:Apbb1 UTSW 7 105566600 missense probably damaging 1.00
R7809:Apbb1 UTSW 7 105573807 missense probably benign 0.04
R7995:Apbb1 UTSW 7 105565645 missense probably benign 0.09
Z1088:Apbb1 UTSW 7 105559136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACACTTCTGGTAGCGGAG -3'
(R):5'- GGATAGGAGACCTTGTGACTG -3'

Sequencing Primer
(F):5'- GCAAAGGGACAGTAACTCTCTG -3'
(R):5'- AGACCTTGTGACTGTGACTGAGC -3'
Posted On2016-11-09