Incidental Mutation 'R5677:Col12a1'
ID442811
Institutional Source Beutler Lab
Gene Symbol Col12a1
Ensembl Gene ENSMUSG00000032332
Gene Namecollagen, type XII, alpha 1
Synonyms
MMRRC Submission 043316-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R5677 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location79598991-79718831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79699321 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 607 (R607G)
Ref Sequence ENSEMBL: ENSMUSP00000112604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071750] [ENSMUST00000121227]
Predicted Effect probably damaging
Transcript: ENSMUST00000071750
AA Change: R607G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071662
Gene: ENSMUSG00000032332
AA Change: R607G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 1.7e-8 PFAM
Pfam:Collagen 2802 2855 6.5e-9 PFAM
Pfam:Collagen 2844 2904 1.1e-9 PFAM
Pfam:Collagen 2939 2994 4.6e-8 PFAM
low complexity region 3011 3044 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121227
AA Change: R607G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112604
Gene: ENSMUSG00000032332
AA Change: R607G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 4.7e-9 PFAM
Pfam:Collagen 2802 2861 2.9e-9 PFAM
Pfam:Collagen 2838 2900 7.1e-8 PFAM
Pfam:Collagen 2935 2990 1.3e-8 PFAM
low complexity region 3007 3040 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150289
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XII collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XII collagen is a homotrimer found in association with type I collagen, an association that is thought to modify the interactions between collagen I fibrils and the surrounding matrix. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial perinatal lethality, decreased body weight, shorter and slender long bones, altered vertebrae structure, kyphosis, decreased bone strength, and abnormalities in osteoblast differentiation and bone matrix formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik C T 10: 28,986,229 V22I probably benign Het
4930430A15Rik T C 2: 111,211,565 T342A probably benign Het
4931423N10Rik T A 2: 23,212,718 L156Q probably damaging Het
Abca8a A T 11: 110,038,399 V1296D possibly damaging Het
Abca8b C T 11: 109,940,861 S1328N probably damaging Het
Adcy1 G A 11: 7,161,914 M926I probably damaging Het
Aff4 G T 11: 53,400,275 M687I possibly damaging Het
Agbl2 T A 2: 90,807,978 Y636N possibly damaging Het
Agtr1a A T 13: 30,381,584 I211F probably damaging Het
Alkbh8 T G 9: 3,385,147 S480A possibly damaging Het
Ankrd13b A T 11: 77,477,544 V84E probably damaging Het
Ap3b1 C T 13: 94,528,196 T881I unknown Het
Apbb1 A C 7: 105,559,246 D617E probably damaging Het
Apobec4 A G 1: 152,757,282 R354G probably benign Het
BC003331 G A 1: 150,374,837 L319F probably damaging Het
Brdt T G 5: 107,348,617 C198W possibly damaging Het
Cacna1b G T 2: 24,679,358 H851Q possibly damaging Het
Car2 G T 3: 14,898,055 V217F possibly damaging Het
Ccdc24 A C 4: 117,869,880 probably benign Het
Chodl C A 16: 78,941,315 A57E probably damaging Het
Clgn G T 8: 83,409,538 C185F probably damaging Het
Cltc G T 11: 86,705,242 N1223K probably damaging Het
Cnot10 T C 9: 114,629,093 N115S probably damaging Het
Cpd A G 11: 76,799,825 V835A probably benign Het
Csmd3 G C 15: 48,622,051 L153V probably damaging Het
Ctr9 A G 7: 111,044,002 H527R probably benign Het
Cwc22 G A 2: 77,929,443 R87W probably damaging Het
D930020B18Rik T A 10: 121,669,201 N107K probably benign Het
Dgkg C A 16: 22,570,171 V418L probably benign Het
Dhx40 A G 11: 86,800,963 probably null Het
Diaph1 A T 18: 37,855,951 M910K probably damaging Het
Diras2 T A 13: 52,507,675 M199L possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock5 T A 14: 67,777,603 Q1302H probably benign Het
Dync1i2 T C 2: 71,228,623 S90P probably benign Het
E2f8 A T 7: 48,867,195 V812E probably damaging Het
Egfem1 C A 3: 29,690,174 Q521K probably damaging Het
Fbxl18 A T 5: 142,878,720 C699* probably null Het
Fgf3 C T 7: 144,838,783 R26* probably null Het
Fpr-rs7 T G 17: 20,114,103 I42L probably benign Het
Gm13101 A T 4: 143,965,138 D338E possibly damaging Het
Gm3159 T A 14: 4,398,582 M91K probably damaging Het
Gprin3 A G 6: 59,353,892 S477P possibly damaging Het
Grm8 A T 6: 27,761,204 probably null Het
Hepacam2 A T 6: 3,466,142 D420E probably damaging Het
Hmcn1 A T 1: 150,609,778 W4358R probably benign Het
Ifna6 G A 4: 88,827,719 A102T probably benign Het
Ighv2-2 T C 12: 113,588,522 Q32R probably benign Het
Igkv1-131 T A 6: 67,766,258 Q47L possibly damaging Het
Il16 T C 7: 83,674,553 E263G probably damaging Het
Kansl1 A T 11: 104,335,148 C981S probably benign Het
Lrp1 A T 10: 127,574,429 F1483I probably damaging Het
Ltf T C 9: 111,020,912 M1T probably null Het
Ly75 C T 2: 60,299,082 R1653H probably benign Het
Macrod2 T C 2: 142,176,667 F240S probably damaging Het
Man1c1 T C 4: 134,569,060 E433G probably damaging Het
Mansc4 A T 6: 147,081,549 M130K probably benign Het
Mccc1 C T 3: 35,990,048 probably null Het
Mink1 G T 11: 70,605,165 R75L possibly damaging Het
Mst1 A G 9: 108,081,286 D65G probably damaging Het
Myo9b C T 8: 71,343,686 A857V probably damaging Het
Ndufa4 A G 6: 11,900,575 V70A probably benign Het
Npat T A 9: 53,555,100 S230T probably benign Het
Nr1d1 A G 11: 98,771,308 Y167H probably damaging Het
Oca2 A G 7: 56,414,462 D735G probably damaging Het
Olfr13 T C 6: 43,174,331 V115A probably benign Het
Olfr1359 C T 13: 21,703,223 T74I probably benign Het
Olfr1383 A G 11: 49,523,944 T74A probably damaging Het
Olfr835 T A 9: 19,035,558 I145N possibly damaging Het
Otop1 A G 5: 38,300,163 Y422C probably damaging Het
Pde4dip G A 3: 97,841,648 R126* probably null Het
Pdp2 C T 8: 104,594,688 P390S probably damaging Het
Pds5b A T 5: 150,716,461 T14S possibly damaging Het
Pfkp T C 13: 6,588,595 E580G probably damaging Het
Piezo2 A T 18: 63,117,696 L212Q possibly damaging Het
Piezo2 G C 18: 63,117,697 L444V probably benign Het
Pla2g4d T A 2: 120,278,948 T207S possibly damaging Het
Plk2 C A 13: 110,399,057 T471K possibly damaging Het
Ppp1r3g G A 13: 35,969,262 E222K probably damaging Het
Prkcg A G 7: 3,323,458 D480G probably damaging Het
Pxdc1 T A 13: 34,652,195 T81S probably benign Het
Rnf150 A T 8: 83,003,599 K253* probably null Het
Rsg1 C T 4: 141,219,866 P186L probably benign Het
Sae1 T C 7: 16,370,462 probably null Het
Scin C T 12: 40,063,259 D538N probably damaging Het
Serpinb3c C A 1: 107,271,803 K329N probably damaging Het
Sgo2b T A 8: 63,926,974 K941N possibly damaging Het
Six1 C T 12: 73,046,284 S48N possibly damaging Het
Slc39a8 G A 3: 135,884,688 G381R probably damaging Het
Slc9b1 A G 3: 135,357,559 K35E unknown Het
Srek1 C T 13: 103,759,244 A274T probably damaging Het
Steap2 A T 5: 5,677,497 Y279* probably null Het
Svil T A 18: 5,046,823 L110* probably null Het
Syncrip T C 9: 88,456,709 probably benign Het
Tcf20 A G 15: 82,853,242 I1336T probably benign Het
Tecpr1 T A 5: 144,218,633 K36* probably null Het
Tenm2 A G 11: 36,141,683 V670A probably damaging Het
Thbd G A 2: 148,407,366 T194I probably damaging Het
Tm9sf2 A T 14: 122,151,962 probably null Het
Tmtc4 A T 14: 122,950,499 I225N probably damaging Het
Tpp1 C T 7: 105,747,536 V425M probably damaging Het
Trbc2 T A 6: 41,547,812 Y144* probably null Het
Trps1 T C 15: 50,846,108 D282G probably damaging Het
Tsc22d4 T A 5: 137,747,142 S9R probably damaging Het
Upp1 T A 11: 9,136,025 D287E probably benign Het
Uso1 A C 5: 92,201,299 Q916H probably damaging Het
Uty T A Y: 1,134,902 Y884F probably damaging Het
Vmn1r222 T C 13: 23,232,780 R88G probably damaging Het
Vmn1r79 T C 7: 12,177,001 V270A possibly damaging Het
Zbtb22 T C 17: 33,917,735 S285P probably benign Het
Zfp385a A G 15: 103,318,065 V82A probably damaging Het
Zfp59 T C 7: 27,854,169 F349L probably benign Het
Zfp780b T G 7: 27,962,799 H777P probably benign Het
Zfp82 T C 7: 30,057,124 T178A probably benign Het
Zfp850 T C 7: 27,989,088 Y565C probably damaging Het
Zfp957 A G 14: 79,212,767 Y531H probably damaging Het
Other mutations in Col12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col12a1 APN 9 79681537 missense possibly damaging 0.55
IGL00434:Col12a1 APN 9 79653332 missense probably benign 0.27
IGL00465:Col12a1 APN 9 79697581 missense probably damaging 1.00
IGL00568:Col12a1 APN 9 79651477 missense probably damaging 1.00
IGL00576:Col12a1 APN 9 79647652 missense probably damaging 1.00
IGL00580:Col12a1 APN 9 79692226 missense probably benign 0.05
IGL01015:Col12a1 APN 9 79633741 missense probably damaging 1.00
IGL01124:Col12a1 APN 9 79703847 missense probably damaging 1.00
IGL01138:Col12a1 APN 9 79678053 missense probably damaging 1.00
IGL01295:Col12a1 APN 9 79643926 missense probably damaging 1.00
IGL01630:Col12a1 APN 9 79657366 missense probably damaging 1.00
IGL01648:Col12a1 APN 9 79601169 makesense probably null
IGL01878:Col12a1 APN 9 79649975 missense possibly damaging 0.72
IGL01921:Col12a1 APN 9 79650017 missense possibly damaging 0.50
IGL02064:Col12a1 APN 9 79692372 missense probably benign 0.06
IGL02123:Col12a1 APN 9 79662458 critical splice donor site probably null
IGL02312:Col12a1 APN 9 79681515 missense probably damaging 1.00
IGL02320:Col12a1 APN 9 79616021 critical splice donor site probably null
IGL02328:Col12a1 APN 9 79682066 missense probably damaging 1.00
IGL02342:Col12a1 APN 9 79649896 splice site probably null
IGL02355:Col12a1 APN 9 79630711 splice site probably benign
IGL02362:Col12a1 APN 9 79630711 splice site probably benign
IGL02396:Col12a1 APN 9 79662583 missense probably benign
IGL02449:Col12a1 APN 9 79641469 missense probably damaging 1.00
IGL02682:Col12a1 APN 9 79699341 missense probably damaging 1.00
IGL02751:Col12a1 APN 9 79613859 unclassified probably benign
IGL02801:Col12a1 APN 9 79608414 splice site probably null
IGL03001:Col12a1 APN 9 79633673 missense probably damaging 1.00
IGL03027:Col12a1 APN 9 79641551 missense probably benign 0.40
IGL03090:Col12a1 APN 9 79678370 missense probably damaging 1.00
IGL03115:Col12a1 APN 9 79681437 missense probably damaging 1.00
IGL03220:Col12a1 APN 9 79699483 missense probably damaging 1.00
IGL03240:Col12a1 APN 9 79678383 splice site probably null
IGL03348:Col12a1 APN 9 79693430 missense possibly damaging 0.88
Feast UTSW 9 79700262 missense probably benign 0.00
hardly UTSW 9 79700350 nonsense probably null
hearty UTSW 9 79643966 missense probably damaging 1.00
Hefty UTSW 9 79662454 splice site probably benign
P0045:Col12a1 UTSW 9 79647611 missense probably damaging 0.99
PIT4260001:Col12a1 UTSW 9 79651380 critical splice donor site probably null
PIT4280001:Col12a1 UTSW 9 79678105 missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79651385 missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79651385 missense probably damaging 1.00
R0240:Col12a1 UTSW 9 79652033 missense probably benign 0.02
R0276:Col12a1 UTSW 9 79630741 nonsense probably null
R0309:Col12a1 UTSW 9 79600011 unclassified probably null
R0336:Col12a1 UTSW 9 79702345 missense probably damaging 0.98
R0376:Col12a1 UTSW 9 79693494 missense probably benign 0.10
R0413:Col12a1 UTSW 9 79699360 missense probably damaging 0.99
R0504:Col12a1 UTSW 9 79681468 missense possibly damaging 0.90
R0542:Col12a1 UTSW 9 79605328 critical splice donor site probably null
R0610:Col12a1 UTSW 9 79707848 missense probably benign
R0631:Col12a1 UTSW 9 79703376 missense probably damaging 1.00
R0637:Col12a1 UTSW 9 79656735 missense probably benign 0.00
R0667:Col12a1 UTSW 9 79628462 missense probably damaging 1.00
R0711:Col12a1 UTSW 9 79652035 missense probably damaging 1.00
R0717:Col12a1 UTSW 9 79612419 missense probably damaging 1.00
R0762:Col12a1 UTSW 9 79681374 splice site probably benign
R0787:Col12a1 UTSW 9 79638485 missense probably damaging 0.99
R0890:Col12a1 UTSW 9 79700402 missense probably damaging 0.97
R0900:Col12a1 UTSW 9 79684253 missense possibly damaging 0.91
R1109:Col12a1 UTSW 9 79699723 missense probably damaging 1.00
R1264:Col12a1 UTSW 9 79620089 missense probably benign 0.09
R1321:Col12a1 UTSW 9 79617709 nonsense probably null
R1344:Col12a1 UTSW 9 79699555 nonsense probably null
R1387:Col12a1 UTSW 9 79681375 splice site probably benign
R1511:Col12a1 UTSW 9 79699552 missense probably benign 0.02
R1523:Col12a1 UTSW 9 79660996 missense probably benign 0.01
R1526:Col12a1 UTSW 9 79656798 missense probably benign 0.44
R1564:Col12a1 UTSW 9 79613840 missense probably damaging 1.00
R1595:Col12a1 UTSW 9 79602254 missense probably damaging 1.00
R1603:Col12a1 UTSW 9 79612962 missense probably damaging 1.00
R1673:Col12a1 UTSW 9 79693538 missense probably benign 0.00
R1730:Col12a1 UTSW 9 79628378 missense possibly damaging 0.93
R1737:Col12a1 UTSW 9 79703451 missense probably damaging 1.00
R1739:Col12a1 UTSW 9 79633468 missense probably damaging 0.98
R1748:Col12a1 UTSW 9 79672997 missense probably benign 0.01
R1778:Col12a1 UTSW 9 79604585 splice site probably benign
R1845:Col12a1 UTSW 9 79697541 missense probably benign 0.09
R1864:Col12a1 UTSW 9 79627103 splice site probably null
R1876:Col12a1 UTSW 9 79678281 nonsense probably null
R1934:Col12a1 UTSW 9 79604522 nonsense probably null
R1942:Col12a1 UTSW 9 79635466 missense probably damaging 1.00
R1950:Col12a1 UTSW 9 79630549 missense possibly damaging 0.62
R2027:Col12a1 UTSW 9 79645793 critical splice acceptor site probably null
R2061:Col12a1 UTSW 9 79617705 missense possibly damaging 0.88
R2064:Col12a1 UTSW 9 79662454 splice site probably benign
R2070:Col12a1 UTSW 9 79647696 missense probably benign 0.00
R2112:Col12a1 UTSW 9 79643899 missense possibly damaging 0.93
R2209:Col12a1 UTSW 9 79692352 missense possibly damaging 0.83
R2275:Col12a1 UTSW 9 79635427 missense probably damaging 0.99
R2330:Col12a1 UTSW 9 79633657 missense probably damaging 0.99
R2373:Col12a1 UTSW 9 79656813 missense probably benign 0.03
R2425:Col12a1 UTSW 9 79678366 missense probably damaging 1.00
R2428:Col12a1 UTSW 9 79602251 missense probably benign 0.30
R2437:Col12a1 UTSW 9 79692219 missense probably damaging 0.97
R2831:Col12a1 UTSW 9 79697401 missense probably null 0.99
R2851:Col12a1 UTSW 9 79678332 missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2874:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2904:Col12a1 UTSW 9 79652025 missense probably damaging 1.00
R2905:Col12a1 UTSW 9 79652025 missense probably damaging 1.00
R2991:Col12a1 UTSW 9 79700265 missense probably damaging 1.00
R3402:Col12a1 UTSW 9 79643947 missense probably damaging 1.00
R3429:Col12a1 UTSW 9 79680311 missense probably benign
R3430:Col12a1 UTSW 9 79680311 missense probably benign
R3547:Col12a1 UTSW 9 79633416 missense probably damaging 1.00
R3789:Col12a1 UTSW 9 79639723 missense possibly damaging 0.96
R4091:Col12a1 UTSW 9 79702364 missense probably damaging 0.99
R4328:Col12a1 UTSW 9 79700389 missense possibly damaging 0.91
R4382:Col12a1 UTSW 9 79630741 nonsense probably null
R4392:Col12a1 UTSW 9 79662488 missense probably damaging 1.00
R4405:Col12a1 UTSW 9 79639965 critical splice donor site probably null
R4465:Col12a1 UTSW 9 79672910 missense possibly damaging 0.62
R4521:Col12a1 UTSW 9 79633357 missense probably benign 0.00
R4612:Col12a1 UTSW 9 79616057 missense probably damaging 0.99
R4613:Col12a1 UTSW 9 79647601 missense probably benign 0.03
R4649:Col12a1 UTSW 9 79639794 missense probably damaging 1.00
R4651:Col12a1 UTSW 9 79612946 missense probably damaging 1.00
R4652:Col12a1 UTSW 9 79612946 missense probably damaging 1.00
R4738:Col12a1 UTSW 9 79699282 missense probably damaging 1.00
R4745:Col12a1 UTSW 9 79652086 splice site probably null
R4761:Col12a1 UTSW 9 79657310 missense probably benign 0.34
R4784:Col12a1 UTSW 9 79678494 missense possibly damaging 0.50
R4785:Col12a1 UTSW 9 79678494 missense possibly damaging 0.50
R4809:Col12a1 UTSW 9 79693567 missense probably benign 0.10
R4821:Col12a1 UTSW 9 79715340 intron probably benign
R4925:Col12a1 UTSW 9 79674795 missense probably damaging 1.00
R4938:Col12a1 UTSW 9 79700350 nonsense probably null
R5034:Col12a1 UTSW 9 79657367 missense probably damaging 1.00
R5133:Col12a1 UTSW 9 79605174 missense probably damaging 0.99
R5138:Col12a1 UTSW 9 79643966 missense probably damaging 1.00
R5145:Col12a1 UTSW 9 79706300 missense probably benign 0.00
R5152:Col12a1 UTSW 9 79656748 missense probably damaging 1.00
R5237:Col12a1 UTSW 9 79700262 missense probably benign 0.00
R5268:Col12a1 UTSW 9 79678047 missense probably damaging 0.99
R5328:Col12a1 UTSW 9 79620060 missense probably damaging 0.96
R5372:Col12a1 UTSW 9 79678366 missense probably damaging 1.00
R5440:Col12a1 UTSW 9 79614363 missense probably benign 0.07
R5496:Col12a1 UTSW 9 79602185 splice site probably benign
R5537:Col12a1 UTSW 9 79699590 missense probably damaging 1.00
R5596:Col12a1 UTSW 9 79703759 missense probably damaging 1.00
R5715:Col12a1 UTSW 9 79616065 nonsense probably null
R5796:Col12a1 UTSW 9 79703829 missense possibly damaging 0.73
R5829:Col12a1 UTSW 9 79633673 missense probably damaging 1.00
R5865:Col12a1 UTSW 9 79604478 missense probably benign 0.00
R5919:Col12a1 UTSW 9 79602298 missense probably damaging 0.99
R5974:Col12a1 UTSW 9 79682127 missense probably damaging 0.99
R5981:Col12a1 UTSW 9 79678506 missense probably damaging 0.99
R5982:Col12a1 UTSW 9 79630560 missense probably damaging 1.00
R6027:Col12a1 UTSW 9 79656578 critical splice donor site probably null
R6090:Col12a1 UTSW 9 79692393 missense probably damaging 1.00
R6293:Col12a1 UTSW 9 79614358 missense probably benign 0.00
R6393:Col12a1 UTSW 9 79655485 missense probably damaging 0.99
R6457:Col12a1 UTSW 9 79645691 missense probably damaging 1.00
R6505:Col12a1 UTSW 9 79647605 missense probably damaging 0.98
R6508:Col12a1 UTSW 9 79649949 missense probably damaging 1.00
R6620:Col12a1 UTSW 9 79620049 missense probably damaging 0.98
R6718:Col12a1 UTSW 9 79699605 missense probably damaging 1.00
R6752:Col12a1 UTSW 9 79633424 missense possibly damaging 0.72
R6774:Col12a1 UTSW 9 79706337 missense possibly damaging 0.65
R6872:Col12a1 UTSW 9 79677234 missense probably damaging 1.00
R6884:Col12a1 UTSW 9 79639809 missense possibly damaging 0.92
R6935:Col12a1 UTSW 9 79700500 missense possibly damaging 0.76
R7198:Col12a1 UTSW 9 79650032 missense possibly damaging 0.56
R7296:Col12a1 UTSW 9 79682066 missense probably damaging 1.00
R7365:Col12a1 UTSW 9 79706360 missense probably damaging 0.99
R7466:Col12a1 UTSW 9 79655407 missense possibly damaging 0.95
R7516:Col12a1 UTSW 9 79612910 splice site probably null
R7584:Col12a1 UTSW 9 79703296 critical splice donor site probably null
R7670:Col12a1 UTSW 9 79631643 missense probably damaging 1.00
R7678:Col12a1 UTSW 9 79651486 missense probably damaging 0.99
R7702:Col12a1 UTSW 9 79681521 missense probably damaging 1.00
R7796:Col12a1 UTSW 9 79678551 missense possibly damaging 0.88
X0021:Col12a1 UTSW 9 79608485 missense probably damaging 1.00
X0058:Col12a1 UTSW 9 79602224 missense possibly damaging 0.66
X0061:Col12a1 UTSW 9 79612392 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACACTAAGTCCCATGGTTTTCC -3'
(R):5'- TGTGCCAAACAAAGGTTCCAG -3'

Sequencing Primer
(F):5'- TCCATAGAAGTTGGATGTTTTCTTG -3'
(R):5'- GGTTCCAGAAGCAACGTACCG -3'
Posted On2016-11-09