Mutagenetix > Incidental Mutation

Incidental Mutation 'R5677:Col12a1'

442811

Institutional Source

Beutler Lab

Gene Symbol

Col12a1

Ensembl Gene

ENSMUSG00000032332

Gene Name

collagen, type XII, alpha 1

Synonyms

MMRRC Submission

043316-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.768) question?

Stock #

R5677 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79598991-79718831 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79699321 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 607 (R607G)

Ref Sequence

ENSEMBL: ENSMUSP00000112604 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071750] [ENSMUST00000121227]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000071750
AA Change: R607G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071662
Gene: ENSMUSG00000032332
AA Change: R607G

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FN3	25	103	2.29e-10	SMART
low complexity region	114	129	N/A	INTRINSIC
VWA	138	317	4e-63	SMART
FN3	334	413	1.47e-8	SMART
VWA	438	617	2.41e-57	SMART
FN3	632	710	1.62e-10	SMART
FN3	723	801	2.91e-12	SMART
FN3	814	892	6.05e-10	SMART
FN3	905	984	2.74e-8	SMART
FN3	995	1074	1.24e-6	SMART
FN3	1087	1166	5.78e-7	SMART
VWA	1197	1376	2.02e-59	SMART
FN3	1385	1463	1.13e-9	SMART
FN3	1474	1554	1.07e-10	SMART
FN3	1566	1643	3.73e-10	SMART
FN3	1655	1734	2.94e-8	SMART
FN3	1755	1834	1.54e-11	SMART
FN3	1846	1924	1.45e-7	SMART
FN3	1936	2015	1.47e-8	SMART
FN3	2027	2106	1.21e-9	SMART
FN3	2118	2195	2.14e-10	SMART
FN3	2206	2285	3.85e-3	SMART
low complexity region	2292	2314	N/A	INTRINSIC
VWA	2323	2503	2.61e-53	SMART
TSPN	2522	2714	1.13e-76	SMART
Pfam:Collagen	2747	2804	1.7e-8	PFAM
Pfam:Collagen	2802	2855	6.5e-9	PFAM
Pfam:Collagen	2844	2904	1.1e-9	PFAM
Pfam:Collagen	2939	2994	4.6e-8	PFAM
low complexity region	3011	3044	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121227
AA Change: R607G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112604
Gene: ENSMUSG00000032332
AA Change: R607G

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FN3	25	103	2.29e-10	SMART
low complexity region	114	129	N/A	INTRINSIC
VWA	138	317	4e-63	SMART
FN3	334	413	1.47e-8	SMART
VWA	438	617	2.41e-57	SMART
FN3	632	710	1.62e-10	SMART
FN3	723	801	2.91e-12	SMART
FN3	814	892	6.05e-10	SMART
FN3	905	984	2.74e-8	SMART
FN3	995	1074	1.24e-6	SMART
FN3	1087	1166	5.78e-7	SMART
VWA	1197	1376	2.02e-59	SMART
FN3	1385	1463	1.13e-9	SMART
FN3	1474	1554	1.07e-10	SMART
FN3	1566	1643	3.73e-10	SMART
FN3	1655	1734	2.94e-8	SMART
FN3	1755	1834	1.54e-11	SMART
FN3	1846	1924	1.45e-7	SMART
FN3	1936	2015	1.47e-8	SMART
FN3	2027	2106	1.21e-9	SMART
FN3	2118	2195	2.14e-10	SMART
FN3	2206	2285	3.85e-3	SMART
low complexity region	2292	2314	N/A	INTRINSIC
VWA	2323	2503	2.61e-53	SMART
TSPN	2522	2714	1.13e-76	SMART
Pfam:Collagen	2747	2804	4.7e-9	PFAM
Pfam:Collagen	2802	2861	2.9e-9	PFAM
Pfam:Collagen	2838	2900	7.1e-8	PFAM
Pfam:Collagen	2935	2990	1.3e-8	PFAM
low complexity region	3007	3040	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150289

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XII collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XII collagen is a homotrimer found in association with type I collagen, an association that is thought to modify the interactions between collagen I fibrils and the surrounding matrix. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial perinatal lethality, decreased body weight, shorter and slender long bones, altered vertebrae structure, kyphosis, decreased bone strength, and abnormalities in osteoblast differentiation and bone matrix formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 116 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	C	T	10: 28,986,229	V22I	probably benign	Het
4930430A15Rik	T	C	2: 111,211,565	T342A	probably benign	Het
4931423N10Rik	T	A	2: 23,212,718	L156Q	probably damaging	Het
Abca8a	A	T	11: 110,038,399	V1296D	possibly damaging	Het
Abca8b	C	T	11: 109,940,861	S1328N	probably damaging	Het
Adcy1	G	A	11: 7,161,914	M926I	probably damaging	Het
Aff4	G	T	11: 53,400,275	M687I	possibly damaging	Het
Agbl2	T	A	2: 90,807,978	Y636N	possibly damaging	Het
Agtr1a	A	T	13: 30,381,584	I211F	probably damaging	Het
Alkbh8	T	G	9: 3,385,147	S480A	possibly damaging	Het
Ankrd13b	A	T	11: 77,477,544	V84E	probably damaging	Het
Ap3b1	C	T	13: 94,528,196	T881I	unknown	Het
Apbb1	A	C	7: 105,559,246	D617E	probably damaging	Het
Apobec4	A	G	1: 152,757,282	R354G	probably benign	Het
BC003331	G	A	1: 150,374,837	L319F	probably damaging	Het
Brdt	T	G	5: 107,348,617	C198W	possibly damaging	Het
Cacna1b	G	T	2: 24,679,358	H851Q	possibly damaging	Het
Car2	G	T	3: 14,898,055	V217F	possibly damaging	Het
Ccdc24	A	C	4: 117,869,880		probably benign	Het
Chodl	C	A	16: 78,941,315	A57E	probably damaging	Het
Clgn	G	T	8: 83,409,538	C185F	probably damaging	Het
Cltc	G	T	11: 86,705,242	N1223K	probably damaging	Het
Cnot10	T	C	9: 114,629,093	N115S	probably damaging	Het
Cpd	A	G	11: 76,799,825	V835A	probably benign	Het
Csmd3	G	C	15: 48,622,051	L153V	probably damaging	Het
Ctr9	A	G	7: 111,044,002	H527R	probably benign	Het
Cwc22	G	A	2: 77,929,443	R87W	probably damaging	Het
D930020B18Rik	T	A	10: 121,669,201	N107K	probably benign	Het
Dgkg	C	A	16: 22,570,171	V418L	probably benign	Het
Dhx40	A	G	11: 86,800,963		probably null	Het
Diaph1	A	T	18: 37,855,951	M910K	probably damaging	Het
Diras2	T	A	13: 52,507,675	M199L	possibly damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dock5	T	A	14: 67,777,603	Q1302H	probably benign	Het
Dync1i2	T	C	2: 71,228,623	S90P	probably benign	Het
E2f8	A	T	7: 48,867,195	V812E	probably damaging	Het
Egfem1	C	A	3: 29,690,174	Q521K	probably damaging	Het
Fbxl18	A	T	5: 142,878,720	C699*	probably null	Het
Fgf3	C	T	7: 144,838,783	R26*	probably null	Het
Fpr-rs7	T	G	17: 20,114,103	I42L	probably benign	Het
Gm13101	A	T	4: 143,965,138	D338E	possibly damaging	Het
Gm3159	T	A	14: 4,398,582	M91K	probably damaging	Het
Gprin3	A	G	6: 59,353,892	S477P	possibly damaging	Het
Grm8	A	T	6: 27,761,204		probably null	Het
Hepacam2	A	T	6: 3,466,142	D420E	probably damaging	Het
Hmcn1	A	T	1: 150,609,778	W4358R	probably benign	Het
Ifna6	G	A	4: 88,827,719	A102T	probably benign	Het
Ighv2-2	T	C	12: 113,588,522	Q32R	probably benign	Het
Igkv1-131	T	A	6: 67,766,258	Q47L	possibly damaging	Het
Il16	T	C	7: 83,674,553	E263G	probably damaging	Het
Kansl1	A	T	11: 104,335,148	C981S	probably benign	Het
Lrp1	A	T	10: 127,574,429	F1483I	probably damaging	Het
Ltf	T	C	9: 111,020,912	M1T	probably null	Het
Ly75	C	T	2: 60,299,082	R1653H	probably benign	Het
Macrod2	T	C	2: 142,176,667	F240S	probably damaging	Het
Man1c1	T	C	4: 134,569,060	E433G	probably damaging	Het
Mansc4	A	T	6: 147,081,549	M130K	probably benign	Het
Mccc1	C	T	3: 35,990,048		probably null	Het
Mink1	G	T	11: 70,605,165	R75L	possibly damaging	Het
Mst1	A	G	9: 108,081,286	D65G	probably damaging	Het
Myo9b	C	T	8: 71,343,686	A857V	probably damaging	Het
Ndufa4	A	G	6: 11,900,575	V70A	probably benign	Het
Npat	T	A	9: 53,555,100	S230T	probably benign	Het
Nr1d1	A	G	11: 98,771,308	Y167H	probably damaging	Het
Oca2	A	G	7: 56,414,462	D735G	probably damaging	Het
Olfr13	T	C	6: 43,174,331	V115A	probably benign	Het
Olfr1359	C	T	13: 21,703,223	T74I	probably benign	Het
Olfr1383	A	G	11: 49,523,944	T74A	probably damaging	Het
Olfr835	T	A	9: 19,035,558	I145N	possibly damaging	Het
Otop1	A	G	5: 38,300,163	Y422C	probably damaging	Het
Pde4dip	G	A	3: 97,841,648	R126*	probably null	Het
Pdp2	C	T	8: 104,594,688	P390S	probably damaging	Het
Pds5b	A	T	5: 150,716,461	T14S	possibly damaging	Het
Pfkp	T	C	13: 6,588,595	E580G	probably damaging	Het
Piezo2	A	T	18: 63,117,696	L212Q	possibly damaging	Het
Piezo2	G	C	18: 63,117,697	L444V	probably benign	Het
Pla2g4d	T	A	2: 120,278,948	T207S	possibly damaging	Het
Plk2	C	A	13: 110,399,057	T471K	possibly damaging	Het
Ppp1r3g	G	A	13: 35,969,262	E222K	probably damaging	Het
Prkcg	A	G	7: 3,323,458	D480G	probably damaging	Het
Pxdc1	T	A	13: 34,652,195	T81S	probably benign	Het
Rnf150	A	T	8: 83,003,599	K253*	probably null	Het
Rsg1	C	T	4: 141,219,866	P186L	probably benign	Het
Sae1	T	C	7: 16,370,462		probably null	Het
Scin	C	T	12: 40,063,259	D538N	probably damaging	Het
Serpinb3c	C	A	1: 107,271,803	K329N	probably damaging	Het
Sgo2b	T	A	8: 63,926,974	K941N	possibly damaging	Het
Six1	C	T	12: 73,046,284	S48N	possibly damaging	Het
Slc39a8	G	A	3: 135,884,688	G381R	probably damaging	Het
Slc9b1	A	G	3: 135,357,559	K35E	unknown	Het
Srek1	C	T	13: 103,759,244	A274T	probably damaging	Het
Steap2	A	T	5: 5,677,497	Y279*	probably null	Het
Svil	T	A	18: 5,046,823	L110*	probably null	Het
Syncrip	T	C	9: 88,456,709		probably benign	Het
Tcf20	A	G	15: 82,853,242	I1336T	probably benign	Het
Tecpr1	T	A	5: 144,218,633	K36*	probably null	Het
Tenm2	A	G	11: 36,141,683	V670A	probably damaging	Het
Thbd	G	A	2: 148,407,366	T194I	probably damaging	Het
Tm9sf2	A	T	14: 122,151,962		probably null	Het
Tmtc4	A	T	14: 122,950,499	I225N	probably damaging	Het
Tpp1	C	T	7: 105,747,536	V425M	probably damaging	Het
Trbc2	T	A	6: 41,547,812	Y144*	probably null	Het
Trps1	T	C	15: 50,846,108	D282G	probably damaging	Het
Tsc22d4	T	A	5: 137,747,142	S9R	probably damaging	Het
Upp1	T	A	11: 9,136,025	D287E	probably benign	Het
Uso1	A	C	5: 92,201,299	Q916H	probably damaging	Het
Uty	T	A	Y: 1,134,902	Y884F	probably damaging	Het
Vmn1r222	T	C	13: 23,232,780	R88G	probably damaging	Het
Vmn1r79	T	C	7: 12,177,001	V270A	possibly damaging	Het
Zbtb22	T	C	17: 33,917,735	S285P	probably benign	Het
Zfp385a	A	G	15: 103,318,065	V82A	probably damaging	Het
Zfp59	T	C	7: 27,854,169	F349L	probably benign	Het
Zfp780b	T	G	7: 27,962,799	H777P	probably benign	Het
Zfp82	T	C	7: 30,057,124	T178A	probably benign	Het
Zfp850	T	C	7: 27,989,088	Y565C	probably damaging	Het
Zfp957	A	G	14: 79,212,767	Y531H	probably damaging	Het

Other mutations in Col12a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Col12a1	APN	9	79681537	missense	possibly damaging	0.55
IGL00434:Col12a1	APN	9	79653332	missense	probably benign	0.27
IGL00465:Col12a1	APN	9	79697581	missense	probably damaging	1.00
IGL00568:Col12a1	APN	9	79651477	missense	probably damaging	1.00
IGL00576:Col12a1	APN	9	79647652	missense	probably damaging	1.00
IGL00580:Col12a1	APN	9	79692226	missense	probably benign	0.05
IGL01015:Col12a1	APN	9	79633741	missense	probably damaging	1.00
IGL01124:Col12a1	APN	9	79703847	missense	probably damaging	1.00
IGL01138:Col12a1	APN	9	79678053	missense	probably damaging	1.00
IGL01295:Col12a1	APN	9	79643926	missense	probably damaging	1.00
IGL01630:Col12a1	APN	9	79657366	missense	probably damaging	1.00
IGL01648:Col12a1	APN	9	79601169	makesense	probably null
IGL01878:Col12a1	APN	9	79649975	missense	possibly damaging	0.72
IGL01921:Col12a1	APN	9	79650017	missense	possibly damaging	0.50
IGL02064:Col12a1	APN	9	79692372	missense	probably benign	0.06
IGL02123:Col12a1	APN	9	79662458	critical splice donor site	probably null
IGL02312:Col12a1	APN	9	79681515	missense	probably damaging	1.00
IGL02320:Col12a1	APN	9	79616021	critical splice donor site	probably null
IGL02328:Col12a1	APN	9	79682066	missense	probably damaging	1.00
IGL02342:Col12a1	APN	9	79649896	splice site	probably null
IGL02355:Col12a1	APN	9	79630711	splice site	probably benign
IGL02362:Col12a1	APN	9	79630711	splice site	probably benign
IGL02396:Col12a1	APN	9	79662583	missense	probably benign
IGL02449:Col12a1	APN	9	79641469	missense	probably damaging	1.00
IGL02682:Col12a1	APN	9	79699341	missense	probably damaging	1.00
IGL02751:Col12a1	APN	9	79613859	unclassified	probably benign
IGL02801:Col12a1	APN	9	79608414	splice site	probably null
IGL03001:Col12a1	APN	9	79633673	missense	probably damaging	1.00
IGL03027:Col12a1	APN	9	79641551	missense	probably benign	0.40
IGL03090:Col12a1	APN	9	79678370	missense	probably damaging	1.00
IGL03115:Col12a1	APN	9	79681437	missense	probably damaging	1.00
IGL03220:Col12a1	APN	9	79699483	missense	probably damaging	1.00
IGL03240:Col12a1	APN	9	79678383	splice site	probably null
IGL03348:Col12a1	APN	9	79693430	missense	possibly damaging	0.88
airship	UTSW	9	79706337	missense	possibly damaging	0.65
dirigible	UTSW	9	79703829	missense	possibly damaging	0.73
Feast	UTSW	9	79700262	missense	probably benign	0.00
hardly	UTSW	9	79700350	nonsense	probably null
hearty	UTSW	9	79643966	missense	probably damaging	1.00
Hefty	UTSW	9	79662454	splice site	probably benign
P0045:Col12a1	UTSW	9	79647611	missense	probably damaging	0.99
PIT4260001:Col12a1	UTSW	9	79651380	critical splice donor site	probably null
PIT4280001:Col12a1	UTSW	9	79678105	missense	probably damaging	1.00
R0015:Col12a1	UTSW	9	79651385	missense	probably damaging	1.00
R0015:Col12a1	UTSW	9	79651385	missense	probably damaging	1.00
R0240:Col12a1	UTSW	9	79652033	missense	probably benign	0.02
R0276:Col12a1	UTSW	9	79630741	nonsense	probably null
R0309:Col12a1	UTSW	9	79600011	splice site	probably null
R0336:Col12a1	UTSW	9	79702345	missense	probably damaging	0.98
R0376:Col12a1	UTSW	9	79693494	missense	probably benign	0.10
R0413:Col12a1	UTSW	9	79699360	missense	probably damaging	0.99
R0504:Col12a1	UTSW	9	79681468	missense	possibly damaging	0.90
R0542:Col12a1	UTSW	9	79605328	critical splice donor site	probably null
R0610:Col12a1	UTSW	9	79707848	missense	probably benign
R0631:Col12a1	UTSW	9	79703376	missense	probably damaging	1.00
R0637:Col12a1	UTSW	9	79656735	missense	probably benign	0.00
R0667:Col12a1	UTSW	9	79628462	missense	probably damaging	1.00
R0711:Col12a1	UTSW	9	79652035	missense	probably damaging	1.00
R0717:Col12a1	UTSW	9	79612419	missense	probably damaging	1.00
R0762:Col12a1	UTSW	9	79681374	splice site	probably benign
R0787:Col12a1	UTSW	9	79638485	missense	probably damaging	0.99
R0890:Col12a1	UTSW	9	79700402	missense	probably damaging	0.97
R0900:Col12a1	UTSW	9	79684253	missense	possibly damaging	0.91
R1109:Col12a1	UTSW	9	79699723	missense	probably damaging	1.00
R1264:Col12a1	UTSW	9	79620089	missense	probably benign	0.09
R1321:Col12a1	UTSW	9	79617709	nonsense	probably null
R1344:Col12a1	UTSW	9	79699555	nonsense	probably null
R1387:Col12a1	UTSW	9	79681375	splice site	probably benign
R1511:Col12a1	UTSW	9	79699552	missense	probably benign	0.02
R1523:Col12a1	UTSW	9	79660996	missense	probably benign	0.01
R1526:Col12a1	UTSW	9	79656798	missense	probably benign	0.44
R1564:Col12a1	UTSW	9	79613840	missense	probably damaging	1.00
R1595:Col12a1	UTSW	9	79602254	missense	probably damaging	1.00
R1603:Col12a1	UTSW	9	79612962	missense	probably damaging	1.00
R1673:Col12a1	UTSW	9	79693538	missense	probably benign	0.00
R1730:Col12a1	UTSW	9	79628378	missense	possibly damaging	0.93
R1737:Col12a1	UTSW	9	79703451	missense	probably damaging	1.00
R1739:Col12a1	UTSW	9	79633468	missense	probably damaging	0.98
R1748:Col12a1	UTSW	9	79672997	missense	probably benign	0.01
R1778:Col12a1	UTSW	9	79604585	splice site	probably benign
R1845:Col12a1	UTSW	9	79697541	missense	probably benign	0.09
R1864:Col12a1	UTSW	9	79627103	splice site	probably null
R1876:Col12a1	UTSW	9	79678281	nonsense	probably null
R1934:Col12a1	UTSW	9	79604522	nonsense	probably null
R1942:Col12a1	UTSW	9	79635466	missense	probably damaging	1.00
R1950:Col12a1	UTSW	9	79630549	missense	possibly damaging	0.62
R2027:Col12a1	UTSW	9	79645793	critical splice acceptor site	probably null
R2061:Col12a1	UTSW	9	79617705	missense	possibly damaging	0.88
R2064:Col12a1	UTSW	9	79662454	splice site	probably benign
R2070:Col12a1	UTSW	9	79647696	missense	probably benign	0.00
R2112:Col12a1	UTSW	9	79643899	missense	possibly damaging	0.93
R2209:Col12a1	UTSW	9	79692352	missense	possibly damaging	0.83
R2275:Col12a1	UTSW	9	79635427	missense	probably damaging	0.99
R2330:Col12a1	UTSW	9	79633657	missense	probably damaging	0.99
R2373:Col12a1	UTSW	9	79656813	missense	probably benign	0.03
R2425:Col12a1	UTSW	9	79678366	missense	probably damaging	1.00
R2428:Col12a1	UTSW	9	79602251	missense	probably benign	0.30
R2437:Col12a1	UTSW	9	79692219	missense	probably damaging	0.97
R2831:Col12a1	UTSW	9	79697401	missense	probably null	0.99
R2851:Col12a1	UTSW	9	79678332	missense	probably damaging	1.00
R2872:Col12a1	UTSW	9	79699549	missense	probably damaging	1.00
R2872:Col12a1	UTSW	9	79699549	missense	probably damaging	1.00
R2874:Col12a1	UTSW	9	79699549	missense	probably damaging	1.00
R2904:Col12a1	UTSW	9	79652025	missense	probably damaging	1.00
R2905:Col12a1	UTSW	9	79652025	missense	probably damaging	1.00
R2991:Col12a1	UTSW	9	79700265	missense	probably damaging	1.00
R3402:Col12a1	UTSW	9	79643947	missense	probably damaging	1.00
R3429:Col12a1	UTSW	9	79680311	missense	probably benign
R3430:Col12a1	UTSW	9	79680311	missense	probably benign
R3547:Col12a1	UTSW	9	79633416	missense	probably damaging	1.00
R3789:Col12a1	UTSW	9	79639723	missense	possibly damaging	0.96
R4091:Col12a1	UTSW	9	79702364	missense	probably damaging	0.99
R4328:Col12a1	UTSW	9	79700389	missense	possibly damaging	0.91
R4382:Col12a1	UTSW	9	79630741	nonsense	probably null
R4392:Col12a1	UTSW	9	79662488	missense	probably damaging	1.00
R4405:Col12a1	UTSW	9	79639965	critical splice donor site	probably null
R4465:Col12a1	UTSW	9	79672910	missense	possibly damaging	0.62
R4521:Col12a1	UTSW	9	79633357	missense	probably benign	0.00
R4612:Col12a1	UTSW	9	79616057	missense	probably damaging	0.99
R4613:Col12a1	UTSW	9	79647601	missense	probably benign	0.03
R4649:Col12a1	UTSW	9	79639794	missense	probably damaging	1.00
R4651:Col12a1	UTSW	9	79612946	missense	probably damaging	1.00
R4652:Col12a1	UTSW	9	79612946	missense	probably damaging	1.00
R4738:Col12a1	UTSW	9	79699282	missense	probably damaging	1.00
R4745:Col12a1	UTSW	9	79652086	splice site	probably null
R4761:Col12a1	UTSW	9	79657310	missense	probably benign	0.34
R4784:Col12a1	UTSW	9	79678494	missense	possibly damaging	0.50
R4785:Col12a1	UTSW	9	79678494	missense	possibly damaging	0.50
R4809:Col12a1	UTSW	9	79693567	missense	probably benign	0.10
R4821:Col12a1	UTSW	9	79715340	intron	probably benign
R4925:Col12a1	UTSW	9	79674795	missense	probably damaging	1.00
R4938:Col12a1	UTSW	9	79700350	nonsense	probably null
R5034:Col12a1	UTSW	9	79657367	missense	probably damaging	1.00
R5133:Col12a1	UTSW	9	79605174	missense	probably damaging	0.99
R5138:Col12a1	UTSW	9	79643966	missense	probably damaging	1.00
R5145:Col12a1	UTSW	9	79706300	missense	probably benign	0.00
R5152:Col12a1	UTSW	9	79656748	missense	probably damaging	1.00
R5237:Col12a1	UTSW	9	79700262	missense	probably benign	0.00
R5268:Col12a1	UTSW	9	79678047	missense	probably damaging	0.99
R5328:Col12a1	UTSW	9	79620060	missense	probably damaging	0.96
R5372:Col12a1	UTSW	9	79678366	missense	probably damaging	1.00
R5440:Col12a1	UTSW	9	79614363	missense	probably benign	0.07
R5496:Col12a1	UTSW	9	79602185	splice site	probably benign
R5537:Col12a1	UTSW	9	79699590	missense	probably damaging	1.00
R5596:Col12a1	UTSW	9	79703759	missense	probably damaging	1.00
R5715:Col12a1	UTSW	9	79616065	nonsense	probably null
R5796:Col12a1	UTSW	9	79703829	missense	possibly damaging	0.73
R5829:Col12a1	UTSW	9	79633673	missense	probably damaging	1.00
R5865:Col12a1	UTSW	9	79604478	missense	probably benign	0.00
R5919:Col12a1	UTSW	9	79602298	missense	probably damaging	0.99
R5974:Col12a1	UTSW	9	79682127	missense	probably damaging	0.99
R5981:Col12a1	UTSW	9	79678506	missense	probably damaging	0.99
R5982:Col12a1	UTSW	9	79630560	missense	probably damaging	1.00
R6027:Col12a1	UTSW	9	79656578	critical splice donor site	probably null
R6090:Col12a1	UTSW	9	79692393	missense	probably damaging	1.00
R6293:Col12a1	UTSW	9	79614358	missense	probably benign	0.00
R6393:Col12a1	UTSW	9	79655485	missense	probably damaging	0.99
R6457:Col12a1	UTSW	9	79645691	missense	probably damaging	1.00
R6505:Col12a1	UTSW	9	79647605	missense	probably damaging	0.98
R6508:Col12a1	UTSW	9	79649949	missense	probably damaging	1.00
R6620:Col12a1	UTSW	9	79620049	missense	probably damaging	0.98
R6718:Col12a1	UTSW	9	79699605	missense	probably damaging	1.00
R6752:Col12a1	UTSW	9	79633424	missense	possibly damaging	0.72
R6774:Col12a1	UTSW	9	79706337	missense	possibly damaging	0.65
R6872:Col12a1	UTSW	9	79677234	missense	probably damaging	1.00
R6884:Col12a1	UTSW	9	79639809	missense	possibly damaging	0.92
R6935:Col12a1	UTSW	9	79700500	missense	possibly damaging	0.76
R7198:Col12a1	UTSW	9	79650032	missense	possibly damaging	0.56
R7296:Col12a1	UTSW	9	79682066	missense	probably damaging	1.00
R7365:Col12a1	UTSW	9	79706360	missense	probably damaging	0.99
R7466:Col12a1	UTSW	9	79655407	missense	possibly damaging	0.95
R7516:Col12a1	UTSW	9	79612910	splice site	probably null
R7584:Col12a1	UTSW	9	79703296	critical splice donor site	probably null
R7624:Col12a1	UTSW	9	79645794	splice site	probably null
R7670:Col12a1	UTSW	9	79631643	missense	probably damaging	1.00
R7678:Col12a1	UTSW	9	79651486	missense	probably damaging	0.99
R7702:Col12a1	UTSW	9	79681521	missense	probably damaging	1.00
R7796:Col12a1	UTSW	9	79678551	missense	possibly damaging	0.88
R7902:Col12a1	UTSW	9	79641581	missense	probably benign	0.00
R7923:Col12a1	UTSW	9	79678493	missense	probably benign	0.00
R7986:Col12a1	UTSW	9	79604392	critical splice donor site	probably null
R8004:Col12a1	UTSW	9	79684401	missense	probably damaging	1.00
R8046:Col12a1	UTSW	9	79706226	critical splice donor site	probably null
R8056:Col12a1	UTSW	9	79599938	missense
R8151:Col12a1	UTSW	9	79630549	missense	possibly damaging	0.62
R8203:Col12a1	UTSW	9	79681549	missense	possibly damaging	0.94
R8221:Col12a1	UTSW	9	79643942	missense	probably damaging	1.00
R8294:Col12a1	UTSW	9	79699312	missense	possibly damaging	0.91
R8309:Col12a1	UTSW	9	79605183	missense	possibly damaging	0.68
R8319:Col12a1	UTSW	9	79648697	missense	probably damaging	0.97
R8351:Col12a1	UTSW	9	79681412	missense	probably damaging	0.97
R8442:Col12a1	UTSW	9	79635499	missense	probably damaging	1.00
R8500:Col12a1	UTSW	9	79609851	missense	probably damaging	1.00
R8682:Col12a1	UTSW	9	79661076	missense	probably benign	0.03
R8700:Col12a1	UTSW	9	79620089	missense	probably benign	0.09
R8859:Col12a1	UTSW	9	79680399	nonsense	probably null
R8898:Col12a1	UTSW	9	79692295	missense	probably benign	0.08
R8930:Col12a1	UTSW	9	79673383	missense	probably benign
R8932:Col12a1	UTSW	9	79673383	missense	probably benign
R8949:Col12a1	UTSW	9	79674688	missense	probably benign	0.17
R8962:Col12a1	UTSW	9	79631619	missense	probably damaging	1.00
R9045:Col12a1	UTSW	9	79674752	missense	probably benign	0.00
R9080:Col12a1	UTSW	9	79609851	missense	probably benign	0.06
R9145:Col12a1	UTSW	9	79620062	missense	probably benign	0.16
R9163:Col12a1	UTSW	9	79641447	critical splice donor site	probably null
R9168:Col12a1	UTSW	9	79641501	nonsense	probably null
R9188:Col12a1	UTSW	9	79602332	missense	probably benign	0.22
R9258:Col12a1	UTSW	9	79706363	missense	probably benign	0.04
R9292:Col12a1	UTSW	9	79678523	missense	probably benign	0.33
R9345:Col12a1	UTSW	9	79633735	missense	probably benign	0.08
R9382:Col12a1	UTSW	9	79682082	missense	probably benign	0.23
R9427:Col12a1	UTSW	9	79682163	missense	probably benign	0.15
R9601:Col12a1	UTSW	9	79617752	missense	probably damaging	0.98
R9653:Col12a1	UTSW	9	79677274	missense	probably benign
R9668:Col12a1	UTSW	9	79639678	nonsense	probably null
R9762:Col12a1	UTSW	9	79619984	missense	possibly damaging	0.82
X0021:Col12a1	UTSW	9	79608485	missense	probably damaging	1.00
X0058:Col12a1	UTSW	9	79602224	missense	possibly damaging	0.66
X0061:Col12a1	UTSW	9	79612392	splice site	probably null
Z1177:Col12a1	UTSW	9	79599986	missense	possibly damaging	0.80
Z1177:Col12a1	UTSW	9	79639696	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ACACTAAGTCCCATGGTTTTCC -3'
(R):5'- TGTGCCAAACAAAGGTTCCAG -3'

Sequencing Primer
(F):5'- TCCATAGAAGTTGGATGTTTTCTTG -3'
(R):5'- GGTTCCAGAAGCAACGTACCG -3'

Posted On

2016-11-09