Incidental Mutation 'R5677:Col12a1'
ID 442811
Institutional Source Beutler Lab
Gene Symbol Col12a1
Ensembl Gene ENSMUSG00000032332
Gene Name collagen, type XII, alpha 1
Synonyms
MMRRC Submission 043316-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.839) question?
Stock # R5677 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 79506273-79626113 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79606603 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 607 (R607G)
Ref Sequence ENSEMBL: ENSMUSP00000112604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071750] [ENSMUST00000121227]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071750
AA Change: R607G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071662
Gene: ENSMUSG00000032332
AA Change: R607G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 1.7e-8 PFAM
Pfam:Collagen 2802 2855 6.5e-9 PFAM
Pfam:Collagen 2844 2904 1.1e-9 PFAM
Pfam:Collagen 2939 2994 4.6e-8 PFAM
low complexity region 3011 3044 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121227
AA Change: R607G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112604
Gene: ENSMUSG00000032332
AA Change: R607G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 4.7e-9 PFAM
Pfam:Collagen 2802 2861 2.9e-9 PFAM
Pfam:Collagen 2838 2900 7.1e-8 PFAM
Pfam:Collagen 2935 2990 1.3e-8 PFAM
low complexity region 3007 3040 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150289
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XII collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XII collagen is a homotrimer found in association with type I collagen, an association that is thought to modify the interactions between collagen I fibrils and the surrounding matrix. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial perinatal lethality, decreased body weight, shorter and slender long bones, altered vertebrae structure, kyphosis, decreased bone strength, and abnormalities in osteoblast differentiation and bone matrix formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik C T 10: 28,862,225 (GRCm39) V22I probably benign Het
Abca8a A T 11: 109,929,225 (GRCm39) V1296D possibly damaging Het
Abca8b C T 11: 109,831,687 (GRCm39) S1328N probably damaging Het
Adcy1 G A 11: 7,111,914 (GRCm39) M926I probably damaging Het
Aff4 G T 11: 53,291,102 (GRCm39) M687I possibly damaging Het
Agbl2 T A 2: 90,638,322 (GRCm39) Y636N possibly damaging Het
Agtr1a A T 13: 30,565,567 (GRCm39) I211F probably damaging Het
Alkbh8 T G 9: 3,385,147 (GRCm39) S480A possibly damaging Het
Ankrd13b A T 11: 77,368,370 (GRCm39) V84E probably damaging Het
Ap3b1 C T 13: 94,664,704 (GRCm39) T881I unknown Het
Apbb1 A C 7: 105,208,453 (GRCm39) D617E probably damaging Het
Apobec4 A G 1: 152,633,033 (GRCm39) R354G probably benign Het
Brdt T G 5: 107,496,483 (GRCm39) C198W possibly damaging Het
Cacna1b G T 2: 24,569,370 (GRCm39) H851Q possibly damaging Het
Car2 G T 3: 14,963,115 (GRCm39) V217F possibly damaging Het
Ccdc24 A C 4: 117,727,077 (GRCm39) probably benign Het
Chodl C A 16: 78,738,203 (GRCm39) A57E probably damaging Het
Clgn G T 8: 84,136,167 (GRCm39) C185F probably damaging Het
Cltc G T 11: 86,596,068 (GRCm39) N1223K probably damaging Het
Cnot10 T C 9: 114,458,161 (GRCm39) N115S probably damaging Het
Cpd A G 11: 76,690,651 (GRCm39) V835A probably benign Het
Cplane2 C T 4: 140,947,177 (GRCm39) P186L probably benign Het
Csmd3 G C 15: 48,485,447 (GRCm39) L153V probably damaging Het
Ctr9 A G 7: 110,643,209 (GRCm39) H527R probably benign Het
Cwc22 G A 2: 77,759,787 (GRCm39) R87W probably damaging Het
D930020B18Rik T A 10: 121,505,106 (GRCm39) N107K probably benign Het
Dgkg C A 16: 22,388,921 (GRCm39) V418L probably benign Het
Dhx40 A G 11: 86,691,789 (GRCm39) probably null Het
Diaph1 A T 18: 37,989,004 (GRCm39) M910K probably damaging Het
Diras2 T A 13: 52,661,711 (GRCm39) M199L possibly damaging Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Dock5 T A 14: 68,015,052 (GRCm39) Q1302H probably benign Het
Dync1i2 T C 2: 71,058,967 (GRCm39) S90P probably benign Het
E2f8 A T 7: 48,516,943 (GRCm39) V812E probably damaging Het
Egfem1 C A 3: 29,744,323 (GRCm39) Q521K probably damaging Het
Fbxl18 A T 5: 142,864,475 (GRCm39) C699* probably null Het
Fgf3 C T 7: 144,392,520 (GRCm39) R26* probably null Het
Fpr-rs7 T G 17: 20,334,365 (GRCm39) I42L probably benign Het
Gm3159 T A 14: 4,398,582 (GRCm38) M91K probably damaging Het
Gprin3 A G 6: 59,330,877 (GRCm39) S477P possibly damaging Het
Grm8 A T 6: 27,761,203 (GRCm39) probably null Het
Hepacam2 A T 6: 3,466,142 (GRCm39) D420E probably damaging Het
Hmcn1 A T 1: 150,485,529 (GRCm39) W4358R probably benign Het
Ifna6 G A 4: 88,745,956 (GRCm39) A102T probably benign Het
Ighv2-2 T C 12: 113,552,142 (GRCm39) Q32R probably benign Het
Igkv1-131 T A 6: 67,743,242 (GRCm39) Q47L possibly damaging Het
Il16 T C 7: 83,323,761 (GRCm39) E263G probably damaging Het
Kansl1 A T 11: 104,225,974 (GRCm39) C981S probably benign Het
Lrp1 A T 10: 127,410,298 (GRCm39) F1483I probably damaging Het
Ltf T C 9: 110,849,980 (GRCm39) M1T probably null Het
Ly75 C T 2: 60,129,426 (GRCm39) R1653H probably benign Het
Macrod2 T C 2: 142,018,587 (GRCm39) F240S probably damaging Het
Man1c1 T C 4: 134,296,371 (GRCm39) E433G probably damaging Het
Mansc4 A T 6: 146,983,047 (GRCm39) M130K probably benign Het
Mccc1 C T 3: 36,044,197 (GRCm39) probably null Het
Mink1 G T 11: 70,495,991 (GRCm39) R75L possibly damaging Het
Mst1 A G 9: 107,958,485 (GRCm39) D65G probably damaging Het
Myo9b C T 8: 71,796,330 (GRCm39) A857V probably damaging Het
Ndufa4 A G 6: 11,900,574 (GRCm39) V70A probably benign Het
Npat T A 9: 53,466,400 (GRCm39) S230T probably benign Het
Nr1d1 A G 11: 98,662,134 (GRCm39) Y167H probably damaging Het
Oca2 A G 7: 56,064,210 (GRCm39) D735G probably damaging Het
Odr4 G A 1: 150,250,588 (GRCm39) L319F probably damaging Het
Or2a7 T C 6: 43,151,265 (GRCm39) V115A probably benign Het
Or2b2 C T 13: 21,887,393 (GRCm39) T74I probably benign Het
Or2y13 A G 11: 49,414,771 (GRCm39) T74A probably damaging Het
Or7g20 T A 9: 18,946,854 (GRCm39) I145N possibly damaging Het
Otop1 A G 5: 38,457,507 (GRCm39) Y422C probably damaging Het
Pde4dip G A 3: 97,748,964 (GRCm39) R126* probably null Het
Pdp2 C T 8: 105,321,320 (GRCm39) P390S probably damaging Het
Pds5b A T 5: 150,639,926 (GRCm39) T14S possibly damaging Het
Pfkp T C 13: 6,638,631 (GRCm39) E580G probably damaging Het
Piezo2 A T 18: 63,250,767 (GRCm39) L212Q possibly damaging Het
Piezo2 G C 18: 63,250,768 (GRCm39) L444V probably benign Het
Pla2g4d T A 2: 120,109,429 (GRCm39) T207S possibly damaging Het
Plk2 C A 13: 110,535,591 (GRCm39) T471K possibly damaging Het
Potefam1 T C 2: 111,041,910 (GRCm39) T342A probably benign Het
Potegl T A 2: 23,102,730 (GRCm39) L156Q probably damaging Het
Ppp1r3g G A 13: 36,153,245 (GRCm39) E222K probably damaging Het
Pramel28 A T 4: 143,691,708 (GRCm39) D338E possibly damaging Het
Prkcg A G 7: 3,371,974 (GRCm39) D480G probably damaging Het
Pxdc1 T A 13: 34,836,178 (GRCm39) T81S probably benign Het
Rnf150 A T 8: 83,730,228 (GRCm39) K253* probably null Het
Sae1 T C 7: 16,104,387 (GRCm39) probably null Het
Scin C T 12: 40,113,258 (GRCm39) D538N probably damaging Het
Serpinb3c C A 1: 107,199,533 (GRCm39) K329N probably damaging Het
Sgo2b T A 8: 64,380,008 (GRCm39) K941N possibly damaging Het
Six1 C T 12: 73,093,058 (GRCm39) S48N possibly damaging Het
Slc39a8 G A 3: 135,590,449 (GRCm39) G381R probably damaging Het
Slc9b1 A G 3: 135,063,320 (GRCm39) K35E unknown Het
Srek1 C T 13: 103,895,752 (GRCm39) A274T probably damaging Het
Steap2 A T 5: 5,727,497 (GRCm39) Y279* probably null Het
Svil T A 18: 5,046,823 (GRCm39) L110* probably null Het
Syncrip T C 9: 88,338,762 (GRCm39) probably benign Het
Tcf20 A G 15: 82,737,443 (GRCm39) I1336T probably benign Het
Tecpr1 T A 5: 144,155,451 (GRCm39) K36* probably null Het
Tenm2 A G 11: 36,032,510 (GRCm39) V670A probably damaging Het
Thbd G A 2: 148,249,286 (GRCm39) T194I probably damaging Het
Tm9sf2 A T 14: 122,389,374 (GRCm39) probably null Het
Tmtc4 A T 14: 123,187,911 (GRCm39) I225N probably damaging Het
Tpp1 C T 7: 105,396,743 (GRCm39) V425M probably damaging Het
Trbc2 T A 6: 41,524,746 (GRCm39) Y144* probably null Het
Trps1 T C 15: 50,709,504 (GRCm39) D282G probably damaging Het
Tsc22d4 T A 5: 137,745,404 (GRCm39) S9R probably damaging Het
Upp1 T A 11: 9,086,025 (GRCm39) D287E probably benign Het
Uso1 A C 5: 92,349,158 (GRCm39) Q916H probably damaging Het
Uty T A Y: 1,134,902 (GRCm39) Y884F probably damaging Het
Vmn1r222 T C 13: 23,416,950 (GRCm39) R88G probably damaging Het
Vmn1r79 T C 7: 11,910,928 (GRCm39) V270A possibly damaging Het
Zbtb22 T C 17: 34,136,709 (GRCm39) S285P probably benign Het
Zfp385a A G 15: 103,226,492 (GRCm39) V82A probably damaging Het
Zfp59 T C 7: 27,553,594 (GRCm39) F349L probably benign Het
Zfp780b T G 7: 27,662,224 (GRCm39) H777P probably benign Het
Zfp82 T C 7: 29,756,549 (GRCm39) T178A probably benign Het
Zfp850 T C 7: 27,688,513 (GRCm39) Y565C probably damaging Het
Zfp957 A G 14: 79,450,207 (GRCm39) Y531H probably damaging Het
Other mutations in Col12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col12a1 APN 9 79,588,819 (GRCm39) missense possibly damaging 0.55
IGL00434:Col12a1 APN 9 79,560,614 (GRCm39) missense probably benign 0.27
IGL00465:Col12a1 APN 9 79,604,863 (GRCm39) missense probably damaging 1.00
IGL00568:Col12a1 APN 9 79,558,759 (GRCm39) missense probably damaging 1.00
IGL00576:Col12a1 APN 9 79,554,934 (GRCm39) missense probably damaging 1.00
IGL00580:Col12a1 APN 9 79,599,508 (GRCm39) missense probably benign 0.05
IGL01015:Col12a1 APN 9 79,541,023 (GRCm39) missense probably damaging 1.00
IGL01124:Col12a1 APN 9 79,611,129 (GRCm39) missense probably damaging 1.00
IGL01138:Col12a1 APN 9 79,585,335 (GRCm39) missense probably damaging 1.00
IGL01295:Col12a1 APN 9 79,551,208 (GRCm39) missense probably damaging 1.00
IGL01630:Col12a1 APN 9 79,564,648 (GRCm39) missense probably damaging 1.00
IGL01648:Col12a1 APN 9 79,508,451 (GRCm39) makesense probably null
IGL01878:Col12a1 APN 9 79,557,257 (GRCm39) missense possibly damaging 0.72
IGL01921:Col12a1 APN 9 79,557,299 (GRCm39) missense possibly damaging 0.50
IGL02064:Col12a1 APN 9 79,599,654 (GRCm39) missense probably benign 0.06
IGL02123:Col12a1 APN 9 79,569,740 (GRCm39) critical splice donor site probably null
IGL02312:Col12a1 APN 9 79,588,797 (GRCm39) missense probably damaging 1.00
IGL02320:Col12a1 APN 9 79,523,303 (GRCm39) critical splice donor site probably null
IGL02328:Col12a1 APN 9 79,589,348 (GRCm39) missense probably damaging 1.00
IGL02342:Col12a1 APN 9 79,557,178 (GRCm39) splice site probably null
IGL02355:Col12a1 APN 9 79,537,993 (GRCm39) splice site probably benign
IGL02362:Col12a1 APN 9 79,537,993 (GRCm39) splice site probably benign
IGL02396:Col12a1 APN 9 79,569,865 (GRCm39) missense probably benign
IGL02449:Col12a1 APN 9 79,548,751 (GRCm39) missense probably damaging 1.00
IGL02682:Col12a1 APN 9 79,606,623 (GRCm39) missense probably damaging 1.00
IGL02751:Col12a1 APN 9 79,521,141 (GRCm39) unclassified probably benign
IGL02801:Col12a1 APN 9 79,515,696 (GRCm39) splice site probably null
IGL03001:Col12a1 APN 9 79,540,955 (GRCm39) missense probably damaging 1.00
IGL03027:Col12a1 APN 9 79,548,833 (GRCm39) missense probably benign 0.40
IGL03090:Col12a1 APN 9 79,585,652 (GRCm39) missense probably damaging 1.00
IGL03115:Col12a1 APN 9 79,588,719 (GRCm39) missense probably damaging 1.00
IGL03220:Col12a1 APN 9 79,606,765 (GRCm39) missense probably damaging 1.00
IGL03240:Col12a1 APN 9 79,585,665 (GRCm39) splice site probably null
IGL03348:Col12a1 APN 9 79,600,712 (GRCm39) missense possibly damaging 0.88
airship UTSW 9 79,613,619 (GRCm39) missense possibly damaging 0.65
dirigible UTSW 9 79,611,111 (GRCm39) missense possibly damaging 0.73
Feast UTSW 9 79,607,544 (GRCm39) missense probably benign 0.00
hardly UTSW 9 79,607,632 (GRCm39) nonsense probably null
hearty UTSW 9 79,551,248 (GRCm39) missense probably damaging 1.00
Hefty UTSW 9 79,569,736 (GRCm39) splice site probably benign
P0045:Col12a1 UTSW 9 79,554,893 (GRCm39) missense probably damaging 0.99
PIT4260001:Col12a1 UTSW 9 79,558,662 (GRCm39) critical splice donor site probably null
PIT4280001:Col12a1 UTSW 9 79,585,387 (GRCm39) missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79,558,667 (GRCm39) missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79,558,667 (GRCm39) missense probably damaging 1.00
R0240:Col12a1 UTSW 9 79,559,315 (GRCm39) missense probably benign 0.02
R0276:Col12a1 UTSW 9 79,538,023 (GRCm39) nonsense probably null
R0309:Col12a1 UTSW 9 79,507,293 (GRCm39) splice site probably null
R0336:Col12a1 UTSW 9 79,609,627 (GRCm39) missense probably damaging 0.98
R0376:Col12a1 UTSW 9 79,600,776 (GRCm39) missense probably benign 0.10
R0413:Col12a1 UTSW 9 79,606,642 (GRCm39) missense probably damaging 0.99
R0504:Col12a1 UTSW 9 79,588,750 (GRCm39) missense possibly damaging 0.90
R0542:Col12a1 UTSW 9 79,512,610 (GRCm39) critical splice donor site probably null
R0610:Col12a1 UTSW 9 79,615,130 (GRCm39) missense probably benign
R0631:Col12a1 UTSW 9 79,610,658 (GRCm39) missense probably damaging 1.00
R0637:Col12a1 UTSW 9 79,564,017 (GRCm39) missense probably benign 0.00
R0667:Col12a1 UTSW 9 79,535,744 (GRCm39) missense probably damaging 1.00
R0711:Col12a1 UTSW 9 79,559,317 (GRCm39) missense probably damaging 1.00
R0717:Col12a1 UTSW 9 79,519,701 (GRCm39) missense probably damaging 1.00
R0762:Col12a1 UTSW 9 79,588,656 (GRCm39) splice site probably benign
R0787:Col12a1 UTSW 9 79,545,767 (GRCm39) missense probably damaging 0.99
R0890:Col12a1 UTSW 9 79,607,684 (GRCm39) missense probably damaging 0.97
R0900:Col12a1 UTSW 9 79,591,535 (GRCm39) missense possibly damaging 0.91
R1109:Col12a1 UTSW 9 79,607,005 (GRCm39) missense probably damaging 1.00
R1264:Col12a1 UTSW 9 79,527,371 (GRCm39) missense probably benign 0.09
R1321:Col12a1 UTSW 9 79,524,991 (GRCm39) nonsense probably null
R1344:Col12a1 UTSW 9 79,606,837 (GRCm39) nonsense probably null
R1387:Col12a1 UTSW 9 79,588,657 (GRCm39) splice site probably benign
R1511:Col12a1 UTSW 9 79,606,834 (GRCm39) missense probably benign 0.02
R1523:Col12a1 UTSW 9 79,568,278 (GRCm39) missense probably benign 0.01
R1526:Col12a1 UTSW 9 79,564,080 (GRCm39) missense probably benign 0.44
R1564:Col12a1 UTSW 9 79,521,122 (GRCm39) missense probably damaging 1.00
R1595:Col12a1 UTSW 9 79,509,536 (GRCm39) missense probably damaging 1.00
R1603:Col12a1 UTSW 9 79,520,244 (GRCm39) missense probably damaging 1.00
R1673:Col12a1 UTSW 9 79,600,820 (GRCm39) missense probably benign 0.00
R1730:Col12a1 UTSW 9 79,535,660 (GRCm39) missense possibly damaging 0.93
R1737:Col12a1 UTSW 9 79,610,733 (GRCm39) missense probably damaging 1.00
R1739:Col12a1 UTSW 9 79,540,750 (GRCm39) missense probably damaging 0.98
R1748:Col12a1 UTSW 9 79,580,279 (GRCm39) missense probably benign 0.01
R1778:Col12a1 UTSW 9 79,511,867 (GRCm39) splice site probably benign
R1845:Col12a1 UTSW 9 79,604,823 (GRCm39) missense probably benign 0.09
R1864:Col12a1 UTSW 9 79,534,385 (GRCm39) splice site probably null
R1876:Col12a1 UTSW 9 79,585,563 (GRCm39) nonsense probably null
R1934:Col12a1 UTSW 9 79,511,804 (GRCm39) nonsense probably null
R1942:Col12a1 UTSW 9 79,542,748 (GRCm39) missense probably damaging 1.00
R1950:Col12a1 UTSW 9 79,537,831 (GRCm39) missense possibly damaging 0.62
R2027:Col12a1 UTSW 9 79,553,075 (GRCm39) critical splice acceptor site probably null
R2061:Col12a1 UTSW 9 79,524,987 (GRCm39) missense possibly damaging 0.88
R2064:Col12a1 UTSW 9 79,569,736 (GRCm39) splice site probably benign
R2070:Col12a1 UTSW 9 79,554,978 (GRCm39) missense probably benign 0.00
R2112:Col12a1 UTSW 9 79,551,181 (GRCm39) missense possibly damaging 0.93
R2209:Col12a1 UTSW 9 79,599,634 (GRCm39) missense possibly damaging 0.83
R2275:Col12a1 UTSW 9 79,542,709 (GRCm39) missense probably damaging 0.99
R2330:Col12a1 UTSW 9 79,540,939 (GRCm39) missense probably damaging 0.99
R2373:Col12a1 UTSW 9 79,564,095 (GRCm39) missense probably benign 0.03
R2425:Col12a1 UTSW 9 79,585,648 (GRCm39) missense probably damaging 1.00
R2428:Col12a1 UTSW 9 79,509,533 (GRCm39) missense probably benign 0.30
R2437:Col12a1 UTSW 9 79,599,501 (GRCm39) missense probably damaging 0.97
R2831:Col12a1 UTSW 9 79,604,683 (GRCm39) missense probably null 0.99
R2851:Col12a1 UTSW 9 79,585,614 (GRCm39) missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79,606,831 (GRCm39) missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79,606,831 (GRCm39) missense probably damaging 1.00
R2874:Col12a1 UTSW 9 79,606,831 (GRCm39) missense probably damaging 1.00
R2904:Col12a1 UTSW 9 79,559,307 (GRCm39) missense probably damaging 1.00
R2905:Col12a1 UTSW 9 79,559,307 (GRCm39) missense probably damaging 1.00
R2991:Col12a1 UTSW 9 79,607,547 (GRCm39) missense probably damaging 1.00
R3402:Col12a1 UTSW 9 79,551,229 (GRCm39) missense probably damaging 1.00
R3429:Col12a1 UTSW 9 79,587,593 (GRCm39) missense probably benign
R3430:Col12a1 UTSW 9 79,587,593 (GRCm39) missense probably benign
R3547:Col12a1 UTSW 9 79,540,698 (GRCm39) missense probably damaging 1.00
R3789:Col12a1 UTSW 9 79,547,005 (GRCm39) missense possibly damaging 0.96
R4091:Col12a1 UTSW 9 79,609,646 (GRCm39) missense probably damaging 0.99
R4328:Col12a1 UTSW 9 79,607,671 (GRCm39) missense possibly damaging 0.91
R4382:Col12a1 UTSW 9 79,538,023 (GRCm39) nonsense probably null
R4392:Col12a1 UTSW 9 79,569,770 (GRCm39) missense probably damaging 1.00
R4405:Col12a1 UTSW 9 79,547,247 (GRCm39) critical splice donor site probably null
R4465:Col12a1 UTSW 9 79,580,192 (GRCm39) missense possibly damaging 0.62
R4521:Col12a1 UTSW 9 79,540,639 (GRCm39) missense probably benign 0.00
R4612:Col12a1 UTSW 9 79,523,339 (GRCm39) missense probably damaging 0.99
R4613:Col12a1 UTSW 9 79,554,883 (GRCm39) missense probably benign 0.03
R4649:Col12a1 UTSW 9 79,547,076 (GRCm39) missense probably damaging 1.00
R4651:Col12a1 UTSW 9 79,520,228 (GRCm39) missense probably damaging 1.00
R4652:Col12a1 UTSW 9 79,520,228 (GRCm39) missense probably damaging 1.00
R4738:Col12a1 UTSW 9 79,606,564 (GRCm39) missense probably damaging 1.00
R4745:Col12a1 UTSW 9 79,559,368 (GRCm39) splice site probably null
R4761:Col12a1 UTSW 9 79,564,592 (GRCm39) missense probably benign 0.34
R4784:Col12a1 UTSW 9 79,585,776 (GRCm39) missense possibly damaging 0.50
R4785:Col12a1 UTSW 9 79,585,776 (GRCm39) missense possibly damaging 0.50
R4809:Col12a1 UTSW 9 79,600,849 (GRCm39) missense probably benign 0.10
R4821:Col12a1 UTSW 9 79,622,622 (GRCm39) intron probably benign
R4925:Col12a1 UTSW 9 79,582,077 (GRCm39) missense probably damaging 1.00
R4938:Col12a1 UTSW 9 79,607,632 (GRCm39) nonsense probably null
R5034:Col12a1 UTSW 9 79,564,649 (GRCm39) missense probably damaging 1.00
R5133:Col12a1 UTSW 9 79,512,456 (GRCm39) missense probably damaging 0.99
R5138:Col12a1 UTSW 9 79,551,248 (GRCm39) missense probably damaging 1.00
R5145:Col12a1 UTSW 9 79,613,582 (GRCm39) missense probably benign 0.00
R5152:Col12a1 UTSW 9 79,564,030 (GRCm39) missense probably damaging 1.00
R5237:Col12a1 UTSW 9 79,607,544 (GRCm39) missense probably benign 0.00
R5268:Col12a1 UTSW 9 79,585,329 (GRCm39) missense probably damaging 0.99
R5328:Col12a1 UTSW 9 79,527,342 (GRCm39) missense probably damaging 0.96
R5372:Col12a1 UTSW 9 79,585,648 (GRCm39) missense probably damaging 1.00
R5440:Col12a1 UTSW 9 79,521,645 (GRCm39) missense probably benign 0.07
R5496:Col12a1 UTSW 9 79,509,467 (GRCm39) splice site probably benign
R5537:Col12a1 UTSW 9 79,606,872 (GRCm39) missense probably damaging 1.00
R5596:Col12a1 UTSW 9 79,611,041 (GRCm39) missense probably damaging 1.00
R5715:Col12a1 UTSW 9 79,523,347 (GRCm39) nonsense probably null
R5796:Col12a1 UTSW 9 79,611,111 (GRCm39) missense possibly damaging 0.73
R5829:Col12a1 UTSW 9 79,540,955 (GRCm39) missense probably damaging 1.00
R5865:Col12a1 UTSW 9 79,511,760 (GRCm39) missense probably benign 0.00
R5919:Col12a1 UTSW 9 79,509,580 (GRCm39) missense probably damaging 0.99
R5974:Col12a1 UTSW 9 79,589,409 (GRCm39) missense probably damaging 0.99
R5981:Col12a1 UTSW 9 79,585,788 (GRCm39) missense probably damaging 0.99
R5982:Col12a1 UTSW 9 79,537,842 (GRCm39) missense probably damaging 1.00
R6027:Col12a1 UTSW 9 79,563,860 (GRCm39) critical splice donor site probably null
R6090:Col12a1 UTSW 9 79,599,675 (GRCm39) missense probably damaging 1.00
R6293:Col12a1 UTSW 9 79,521,640 (GRCm39) missense probably benign 0.00
R6393:Col12a1 UTSW 9 79,562,767 (GRCm39) missense probably damaging 0.99
R6457:Col12a1 UTSW 9 79,552,973 (GRCm39) missense probably damaging 1.00
R6505:Col12a1 UTSW 9 79,554,887 (GRCm39) missense probably damaging 0.98
R6508:Col12a1 UTSW 9 79,557,231 (GRCm39) missense probably damaging 1.00
R6620:Col12a1 UTSW 9 79,527,331 (GRCm39) missense probably damaging 0.98
R6718:Col12a1 UTSW 9 79,606,887 (GRCm39) missense probably damaging 1.00
R6752:Col12a1 UTSW 9 79,540,706 (GRCm39) missense possibly damaging 0.72
R6774:Col12a1 UTSW 9 79,613,619 (GRCm39) missense possibly damaging 0.65
R6872:Col12a1 UTSW 9 79,584,516 (GRCm39) missense probably damaging 1.00
R6884:Col12a1 UTSW 9 79,547,091 (GRCm39) missense possibly damaging 0.92
R6935:Col12a1 UTSW 9 79,607,782 (GRCm39) missense possibly damaging 0.76
R7198:Col12a1 UTSW 9 79,557,314 (GRCm39) missense possibly damaging 0.56
R7296:Col12a1 UTSW 9 79,589,348 (GRCm39) missense probably damaging 1.00
R7365:Col12a1 UTSW 9 79,613,642 (GRCm39) missense probably damaging 0.99
R7466:Col12a1 UTSW 9 79,562,689 (GRCm39) missense possibly damaging 0.95
R7516:Col12a1 UTSW 9 79,520,192 (GRCm39) splice site probably null
R7584:Col12a1 UTSW 9 79,610,578 (GRCm39) critical splice donor site probably null
R7624:Col12a1 UTSW 9 79,553,076 (GRCm39) splice site probably null
R7670:Col12a1 UTSW 9 79,538,925 (GRCm39) missense probably damaging 1.00
R7678:Col12a1 UTSW 9 79,558,768 (GRCm39) missense probably damaging 0.99
R7702:Col12a1 UTSW 9 79,588,803 (GRCm39) missense probably damaging 1.00
R7796:Col12a1 UTSW 9 79,585,833 (GRCm39) missense possibly damaging 0.88
R7902:Col12a1 UTSW 9 79,548,863 (GRCm39) missense probably benign 0.00
R7923:Col12a1 UTSW 9 79,585,775 (GRCm39) missense probably benign 0.00
R7986:Col12a1 UTSW 9 79,511,674 (GRCm39) critical splice donor site probably null
R8004:Col12a1 UTSW 9 79,591,683 (GRCm39) missense probably damaging 1.00
R8046:Col12a1 UTSW 9 79,613,508 (GRCm39) critical splice donor site probably null
R8056:Col12a1 UTSW 9 79,507,220 (GRCm39) missense
R8151:Col12a1 UTSW 9 79,537,831 (GRCm39) missense possibly damaging 0.62
R8203:Col12a1 UTSW 9 79,588,831 (GRCm39) missense possibly damaging 0.94
R8221:Col12a1 UTSW 9 79,551,224 (GRCm39) missense probably damaging 1.00
R8294:Col12a1 UTSW 9 79,606,594 (GRCm39) missense possibly damaging 0.91
R8309:Col12a1 UTSW 9 79,512,465 (GRCm39) missense possibly damaging 0.68
R8319:Col12a1 UTSW 9 79,555,979 (GRCm39) missense probably damaging 0.97
R8351:Col12a1 UTSW 9 79,588,694 (GRCm39) missense probably damaging 0.97
R8442:Col12a1 UTSW 9 79,542,781 (GRCm39) missense probably damaging 1.00
R8500:Col12a1 UTSW 9 79,517,133 (GRCm39) missense probably damaging 1.00
R8682:Col12a1 UTSW 9 79,568,358 (GRCm39) missense probably benign 0.03
R8700:Col12a1 UTSW 9 79,527,371 (GRCm39) missense probably benign 0.09
R8859:Col12a1 UTSW 9 79,587,681 (GRCm39) nonsense probably null
R8898:Col12a1 UTSW 9 79,599,577 (GRCm39) missense probably benign 0.08
R8930:Col12a1 UTSW 9 79,580,665 (GRCm39) missense probably benign
R8932:Col12a1 UTSW 9 79,580,665 (GRCm39) missense probably benign
R8949:Col12a1 UTSW 9 79,581,970 (GRCm39) missense probably benign 0.17
R8962:Col12a1 UTSW 9 79,538,901 (GRCm39) missense probably damaging 1.00
R9045:Col12a1 UTSW 9 79,582,034 (GRCm39) missense probably benign 0.00
R9080:Col12a1 UTSW 9 79,517,133 (GRCm39) missense probably benign 0.06
R9145:Col12a1 UTSW 9 79,527,344 (GRCm39) missense probably benign 0.16
R9163:Col12a1 UTSW 9 79,548,729 (GRCm39) critical splice donor site probably null
R9168:Col12a1 UTSW 9 79,548,783 (GRCm39) nonsense probably null
R9188:Col12a1 UTSW 9 79,509,614 (GRCm39) missense probably benign 0.22
R9258:Col12a1 UTSW 9 79,613,645 (GRCm39) missense probably benign 0.04
R9292:Col12a1 UTSW 9 79,585,805 (GRCm39) missense probably benign 0.33
R9345:Col12a1 UTSW 9 79,541,017 (GRCm39) missense probably benign 0.08
R9382:Col12a1 UTSW 9 79,589,364 (GRCm39) missense probably benign 0.23
R9427:Col12a1 UTSW 9 79,589,445 (GRCm39) missense probably benign 0.15
R9601:Col12a1 UTSW 9 79,525,034 (GRCm39) missense probably damaging 0.98
R9653:Col12a1 UTSW 9 79,584,556 (GRCm39) missense probably benign
R9668:Col12a1 UTSW 9 79,546,960 (GRCm39) nonsense probably null
R9762:Col12a1 UTSW 9 79,527,266 (GRCm39) missense possibly damaging 0.82
X0021:Col12a1 UTSW 9 79,515,767 (GRCm39) missense probably damaging 1.00
X0058:Col12a1 UTSW 9 79,509,506 (GRCm39) missense possibly damaging 0.66
X0061:Col12a1 UTSW 9 79,519,674 (GRCm39) splice site probably null
Z1177:Col12a1 UTSW 9 79,507,268 (GRCm39) missense possibly damaging 0.80
Z1177:Col12a1 UTSW 9 79,546,978 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACACTAAGTCCCATGGTTTTCC -3'
(R):5'- TGTGCCAAACAAAGGTTCCAG -3'

Sequencing Primer
(F):5'- TCCATAGAAGTTGGATGTTTTCTTG -3'
(R):5'- GGTTCCAGAAGCAACGTACCG -3'
Posted On 2016-11-09