Incidental Mutation 'R5677:Syncrip'
ID 442812
Institutional Source Beutler Lab
Gene Symbol Syncrip
Ensembl Gene ENSMUSG00000032423
Gene Name synaptotagmin binding, cytoplasmic RNA interacting protein
Synonyms hnRNP Q, GRY-RBP, Nsap1, pp68, RRM RNA binding protein GRY-RBP, Nsap1l, 2610109K23Rik, 4632417O19Rik
MMRRC Submission 043316-MU
Accession Numbers

Genbank: NM_019666NM_019796; MGI: 1891690

 

Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock # R5677 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 88447009-88482574 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 88456709 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000069221] [ENSMUST00000172828] [ENSMUST00000173801] [ENSMUST00000174269] [ENSMUST00000174282] [ENSMUST00000174361] [ENSMUST00000174391] [ENSMUST00000174688]
AlphaFold Q7TMK9
Predicted Effect unknown
Transcript: ENSMUST00000069221
AA Change: Y434C
SMART Domains Protein: ENSMUSP00000063744
Gene: ENSMUSG00000032423
AA Change: Y434C

DomainStartEndE-ValueType
RRM 163 237 3.38e-21 SMART
RRM 244 321 2.1e-8 SMART
RRM 339 404 1.4e-18 SMART
low complexity region 428 490 N/A INTRINSIC
low complexity region 494 522 N/A INTRINSIC
low complexity region 526 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154586
SMART Domains Protein: ENSMUSP00000133964
Gene: ENSMUSG00000092541

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
low complexity region 24 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172828
Predicted Effect probably benign
Transcript: ENSMUST00000173131
SMART Domains Protein: ENSMUSP00000134122
Gene: ENSMUSG00000092541

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
low complexity region 30 58 N/A INTRINSIC
low complexity region 62 88 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000173801
AA Change: Y434C
SMART Domains Protein: ENSMUSP00000133649
Gene: ENSMUSG00000032423
AA Change: Y434C

DomainStartEndE-ValueType
RRM 163 237 3.38e-21 SMART
RRM 244 321 2.1e-8 SMART
RRM 339 404 1.4e-18 SMART
low complexity region 428 490 N/A INTRINSIC
low complexity region 494 522 N/A INTRINSIC
low complexity region 526 563 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174269
AA Change: Y399C
SMART Domains Protein: ENSMUSP00000134506
Gene: ENSMUSG00000032423
AA Change: Y399C

DomainStartEndE-ValueType
RRM 163 237 3.38e-21 SMART
RRM 244 303 2.77e0 SMART
RRM 304 369 1.4e-18 SMART
low complexity region 393 455 N/A INTRINSIC
low complexity region 459 487 N/A INTRINSIC
low complexity region 491 518 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174282
AA Change: Y434C
SMART Domains Protein: ENSMUSP00000134071
Gene: ENSMUSG00000032423
AA Change: Y434C

DomainStartEndE-ValueType
RRM 163 237 1.4e-23 SMART
RRM 244 321 9.1e-11 SMART
RRM 339 404 6e-21 SMART
low complexity region 428 490 N/A INTRINSIC
low complexity region 494 522 N/A INTRINSIC
low complexity region 526 552 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174361
AA Change: Y399C
SMART Domains Protein: ENSMUSP00000134722
Gene: ENSMUSG00000032423
AA Change: Y399C

DomainStartEndE-ValueType
RRM 163 237 3.38e-21 SMART
RRM 244 303 2.77e0 SMART
RRM 304 369 1.4e-18 SMART
low complexity region 393 455 N/A INTRINSIC
low complexity region 459 487 N/A INTRINSIC
low complexity region 491 528 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174391
AA Change: Y336C
SMART Domains Protein: ENSMUSP00000134342
Gene: ENSMUSG00000032423
AA Change: Y336C

DomainStartEndE-ValueType
RRM 65 139 3.38e-21 SMART
RRM 146 223 2.1e-8 SMART
RRM 241 306 1.4e-18 SMART
low complexity region 330 392 N/A INTRINSIC
low complexity region 396 424 N/A INTRINSIC
low complexity region 428 455 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174688
AA Change: Y320C
SMART Domains Protein: ENSMUSP00000133716
Gene: ENSMUSG00000032423
AA Change: Y320C

DomainStartEndE-ValueType
RRM 163 224 3.18e-8 SMART
RRM 225 290 1.4e-18 SMART
low complexity region 314 376 N/A INTRINSIC
low complexity region 380 408 N/A INTRINSIC
low complexity region 412 439 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cellular heterogeneous nuclear ribonucleoprotein (hnRNP) family. hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA (hnRNA) and regulate alternative splicing, polyadenylation, and other aspects of mRNA metabolism and transport. The encoded protein plays a role in multiple aspects of mRNA maturation and is associated with several multiprotein complexes including the apoB RNA editing-complex and survival of motor neurons (SMN) complex. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 20. [provided by RefSeq, Dec 2011]
Allele List at MGI

 All alleles(28) : Gene trapped(28)

Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik C T 10: 28,986,229 V22I probably benign Het
4930430A15Rik T C 2: 111,211,565 T342A probably benign Het
4931423N10Rik T A 2: 23,212,718 L156Q probably damaging Het
Abca8a A T 11: 110,038,399 V1296D possibly damaging Het
Abca8b C T 11: 109,940,861 S1328N probably damaging Het
Adcy1 G A 11: 7,161,914 M926I probably damaging Het
Aff4 G T 11: 53,400,275 M687I possibly damaging Het
Agbl2 T A 2: 90,807,978 Y636N possibly damaging Het
Agtr1a A T 13: 30,381,584 I211F probably damaging Het
Alkbh8 T G 9: 3,385,147 S480A possibly damaging Het
Ankrd13b A T 11: 77,477,544 V84E probably damaging Het
Ap3b1 C T 13: 94,528,196 T881I unknown Het
Apbb1 A C 7: 105,559,246 D617E probably damaging Het
Apobec4 A G 1: 152,757,282 R354G probably benign Het
BC003331 G A 1: 150,374,837 L319F probably damaging Het
Brdt T G 5: 107,348,617 C198W possibly damaging Het
Cacna1b G T 2: 24,679,358 H851Q possibly damaging Het
Car2 G T 3: 14,898,055 V217F possibly damaging Het
Ccdc24 A C 4: 117,869,880 probably benign Het
Chodl C A 16: 78,941,315 A57E probably damaging Het
Clgn G T 8: 83,409,538 C185F probably damaging Het
Cltc G T 11: 86,705,242 N1223K probably damaging Het
Cnot10 T C 9: 114,629,093 N115S probably damaging Het
Col12a1 T C 9: 79,699,321 R607G probably damaging Het
Cpd A G 11: 76,799,825 V835A probably benign Het
Csmd3 G C 15: 48,622,051 L153V probably damaging Het
Ctr9 A G 7: 111,044,002 H527R probably benign Het
Cwc22 G A 2: 77,929,443 R87W probably damaging Het
D930020B18Rik T A 10: 121,669,201 N107K probably benign Het
Dgkg C A 16: 22,570,171 V418L probably benign Het
Dhx40 A G 11: 86,800,963 probably null Het
Diaph1 A T 18: 37,855,951 M910K probably damaging Het
Diras2 T A 13: 52,507,675 M199L possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock5 T A 14: 67,777,603 Q1302H probably benign Het
Dync1i2 T C 2: 71,228,623 S90P probably benign Het
E2f8 A T 7: 48,867,195 V812E probably damaging Het
Egfem1 C A 3: 29,690,174 Q521K probably damaging Het
Fbxl18 A T 5: 142,878,720 C699* probably null Het
Fgf3 C T 7: 144,838,783 R26* probably null Het
Fpr-rs7 T G 17: 20,114,103 I42L probably benign Het
Gm13101 A T 4: 143,965,138 D338E possibly damaging Het
Gm3159 T A 14: 4,398,582 M91K probably damaging Het
Gprin3 A G 6: 59,353,892 S477P possibly damaging Het
Grm8 A T 6: 27,761,204 probably null Het
Hepacam2 A T 6: 3,466,142 D420E probably damaging Het
Hmcn1 A T 1: 150,609,778 W4358R probably benign Het
Ifna6 G A 4: 88,827,719 A102T probably benign Het
Ighv2-2 T C 12: 113,588,522 Q32R probably benign Het
Igkv1-131 T A 6: 67,766,258 Q47L possibly damaging Het
Il16 T C 7: 83,674,553 E263G probably damaging Het
Kansl1 A T 11: 104,335,148 C981S probably benign Het
Lrp1 A T 10: 127,574,429 F1483I probably damaging Het
Ltf T C 9: 111,020,912 M1T probably null Het
Ly75 C T 2: 60,299,082 R1653H probably benign Het
Macrod2 T C 2: 142,176,667 F240S probably damaging Het
Man1c1 T C 4: 134,569,060 E433G probably damaging Het
Mansc4 A T 6: 147,081,549 M130K probably benign Het
Mccc1 C T 3: 35,990,048 probably null Het
Mink1 G T 11: 70,605,165 R75L possibly damaging Het
Mst1 A G 9: 108,081,286 D65G probably damaging Het
Myo9b C T 8: 71,343,686 A857V probably damaging Het
Ndufa4 A G 6: 11,900,575 V70A probably benign Het
Npat T A 9: 53,555,100 S230T probably benign Het
Nr1d1 A G 11: 98,771,308 Y167H probably damaging Het
Oca2 A G 7: 56,414,462 D735G probably damaging Het
Olfr13 T C 6: 43,174,331 V115A probably benign Het
Olfr1359 C T 13: 21,703,223 T74I probably benign Het
Olfr1383 A G 11: 49,523,944 T74A probably damaging Het
Olfr835 T A 9: 19,035,558 I145N possibly damaging Het
Otop1 A G 5: 38,300,163 Y422C probably damaging Het
Pde4dip G A 3: 97,841,648 R126* probably null Het
Pdp2 C T 8: 104,594,688 P390S probably damaging Het
Pds5b A T 5: 150,716,461 T14S possibly damaging Het
Pfkp T C 13: 6,588,595 E580G probably damaging Het
Piezo2 A T 18: 63,117,696 L212Q possibly damaging Het
Piezo2 G C 18: 63,117,697 L444V probably benign Het
Pla2g4d T A 2: 120,278,948 T207S possibly damaging Het
Plk2 C A 13: 110,399,057 T471K possibly damaging Het
Ppp1r3g G A 13: 35,969,262 E222K probably damaging Het
Prkcg A G 7: 3,323,458 D480G probably damaging Het
Pxdc1 T A 13: 34,652,195 T81S probably benign Het
Rnf150 A T 8: 83,003,599 K253* probably null Het
Rsg1 C T 4: 141,219,866 P186L probably benign Het
Sae1 T C 7: 16,370,462 probably null Het
Scin C T 12: 40,063,259 D538N probably damaging Het
Serpinb3c C A 1: 107,271,803 K329N probably damaging Het
Sgo2b T A 8: 63,926,974 K941N possibly damaging Het
Six1 C T 12: 73,046,284 S48N possibly damaging Het
Slc39a8 G A 3: 135,884,688 G381R probably damaging Het
Slc9b1 A G 3: 135,357,559 K35E unknown Het
Srek1 C T 13: 103,759,244 A274T probably damaging Het
Steap2 A T 5: 5,677,497 Y279* probably null Het
Svil T A 18: 5,046,823 L110* probably null Het
Tcf20 A G 15: 82,853,242 I1336T probably benign Het
Tecpr1 T A 5: 144,218,633 K36* probably null Het
Tenm2 A G 11: 36,141,683 V670A probably damaging Het
Thbd G A 2: 148,407,366 T194I probably damaging Het
Tm9sf2 A T 14: 122,151,962 probably null Het
Tmtc4 A T 14: 122,950,499 I225N probably damaging Het
Tpp1 C T 7: 105,747,536 V425M probably damaging Het
Trbc2 T A 6: 41,547,812 Y144* probably null Het
Trps1 T C 15: 50,846,108 D282G probably damaging Het
Tsc22d4 T A 5: 137,747,142 S9R probably damaging Het
Upp1 T A 11: 9,136,025 D287E probably benign Het
Uso1 A C 5: 92,201,299 Q916H probably damaging Het
Uty T A Y: 1,134,902 Y884F probably damaging Het
Vmn1r222 T C 13: 23,232,780 R88G probably damaging Het
Vmn1r79 T C 7: 12,177,001 V270A possibly damaging Het
Zbtb22 T C 17: 33,917,735 S285P probably benign Het
Zfp385a A G 15: 103,318,065 V82A probably damaging Het
Zfp59 T C 7: 27,854,169 F349L probably benign Het
Zfp780b T G 7: 27,962,799 H777P probably benign Het
Zfp82 T C 7: 30,057,124 T178A probably benign Het
Zfp850 T C 7: 27,989,088 Y565C probably damaging Het
Zfp957 A G 14: 79,212,767 Y531H probably damaging Het
Other mutations in Syncrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Syncrip APN 9 88456607 utr 3 prime probably benign
IGL01474:Syncrip APN 9 88480747 missense probably benign 0.04
IGL02657:Syncrip APN 9 88456404 missense probably benign 0.23
IGL02659:Syncrip APN 9 88456404 missense probably benign 0.23
IGL02660:Syncrip APN 9 88456404 missense probably benign 0.23
IGL02699:Syncrip APN 9 88456554 utr 3 prime probably benign
IGL02727:Syncrip APN 9 88479879 missense probably damaging 1.00
IGL02801:Syncrip APN 9 88479809 missense probably damaging 1.00
IGL03169:Syncrip APN 9 88456443 utr 3 prime probably benign
IGL03214:Syncrip APN 9 88464643 intron probably benign
3-1:Syncrip UTSW 9 88461674 nonsense probably null
R0426:Syncrip UTSW 9 88456259 intron probably benign
R1500:Syncrip UTSW 9 88479896 missense probably damaging 0.98
R1952:Syncrip UTSW 9 88476874 missense probably damaging 1.00
R2437:Syncrip UTSW 9 88479567 splice site probably benign
R3715:Syncrip UTSW 9 88479685 splice site probably benign
R3779:Syncrip UTSW 9 88476939 missense probably damaging 1.00
R4770:Syncrip UTSW 9 88479852 missense probably damaging 1.00
R6860:Syncrip UTSW 9 88476796 missense probably damaging 0.98
R7286:Syncrip UTSW 9 88464663 missense probably damaging 1.00
R7736:Syncrip UTSW 9 88461668 critical splice donor site probably null
R8778:Syncrip UTSW 9 88456241 missense unknown
R8937:Syncrip UTSW 9 88462847 intron probably benign
Predicted Primers PCR Primer
(F):5'- GAATAACCGGCTCTACCACG -3'
(R):5'- CTTGGGATGTCGTCAGTTAATATC -3'

Sequencing Primer
(F):5'- ACGACCTCTGGATGGAGCAG -3'
(R):5'- ATCTTGGTCTTCTGATTACTGCTAAG -3'
Posted On 2016-11-09