Incidental Mutation 'R5677:Mink1'
ID 442824
Institutional Source Beutler Lab
Gene Symbol Mink1
Ensembl Gene ENSMUSG00000020827
Gene Name misshapen-like kinase 1 (zebrafish)
Synonyms Misshapen/NIKs-related kinase, Map4k6, Ysk2, MINK
MMRRC Submission 043316-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5677 (G1)
Quality Score 182
Status Not validated
Chromosome 11
Chromosomal Location 70453707-70505309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 70495991 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 75 (R75L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102558] [ENSMUST00000102559]
AlphaFold Q9JM52
Predicted Effect possibly damaging
Transcript: ENSMUST00000072237
AA Change: R397L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827
AA Change: R397L

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 837 874 N/A INTRINSIC
CNH 1026 1324 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000072873
AA Change: R397L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827
AA Change: R397L

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 829 853 N/A INTRINSIC
CNH 1019 1317 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000079244
AA Change: R394L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827
AA Change: R394L

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 314 338 N/A INTRINSIC
coiled coil region 348 493 N/A INTRINSIC
low complexity region 554 566 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 826 850 N/A INTRINSIC
CNH 1016 1314 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102558
AA Change: R397L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827
AA Change: R397L

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 792 816 N/A INTRINSIC
CNH 982 1280 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102559
AA Change: R397L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827
AA Change: R397L

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 800 824 N/A INTRINSIC
CNH 990 1288 1.58e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133310
Predicted Effect probably benign
Transcript: ENSMUST00000136663
AA Change: R250L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827
AA Change: R250L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 2.3e-22 PFAM
Pfam:Pkinase 1 143 1.6e-30 PFAM
low complexity region 161 192 N/A INTRINSIC
coiled coil region 204 349 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
low complexity region 500 513 N/A INTRINSIC
low complexity region 573 592 N/A INTRINSIC
low complexity region 691 728 N/A INTRINSIC
CNH 880 1178 1.58e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142650
Predicted Effect unknown
Transcript: ENSMUST00000149845
AA Change: R67L
Predicted Effect possibly damaging
Transcript: ENSMUST00000178764
AA Change: R75L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152857
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik C T 10: 28,862,225 (GRCm39) V22I probably benign Het
Abca8a A T 11: 109,929,225 (GRCm39) V1296D possibly damaging Het
Abca8b C T 11: 109,831,687 (GRCm39) S1328N probably damaging Het
Adcy1 G A 11: 7,111,914 (GRCm39) M926I probably damaging Het
Aff4 G T 11: 53,291,102 (GRCm39) M687I possibly damaging Het
Agbl2 T A 2: 90,638,322 (GRCm39) Y636N possibly damaging Het
Agtr1a A T 13: 30,565,567 (GRCm39) I211F probably damaging Het
Alkbh8 T G 9: 3,385,147 (GRCm39) S480A possibly damaging Het
Ankrd13b A T 11: 77,368,370 (GRCm39) V84E probably damaging Het
Ap3b1 C T 13: 94,664,704 (GRCm39) T881I unknown Het
Apbb1 A C 7: 105,208,453 (GRCm39) D617E probably damaging Het
Apobec4 A G 1: 152,633,033 (GRCm39) R354G probably benign Het
Brdt T G 5: 107,496,483 (GRCm39) C198W possibly damaging Het
Cacna1b G T 2: 24,569,370 (GRCm39) H851Q possibly damaging Het
Car2 G T 3: 14,963,115 (GRCm39) V217F possibly damaging Het
Ccdc24 A C 4: 117,727,077 (GRCm39) probably benign Het
Chodl C A 16: 78,738,203 (GRCm39) A57E probably damaging Het
Clgn G T 8: 84,136,167 (GRCm39) C185F probably damaging Het
Cltc G T 11: 86,596,068 (GRCm39) N1223K probably damaging Het
Cnot10 T C 9: 114,458,161 (GRCm39) N115S probably damaging Het
Col12a1 T C 9: 79,606,603 (GRCm39) R607G probably damaging Het
Cpd A G 11: 76,690,651 (GRCm39) V835A probably benign Het
Cplane2 C T 4: 140,947,177 (GRCm39) P186L probably benign Het
Csmd3 G C 15: 48,485,447 (GRCm39) L153V probably damaging Het
Ctr9 A G 7: 110,643,209 (GRCm39) H527R probably benign Het
Cwc22 G A 2: 77,759,787 (GRCm39) R87W probably damaging Het
D930020B18Rik T A 10: 121,505,106 (GRCm39) N107K probably benign Het
Dgkg C A 16: 22,388,921 (GRCm39) V418L probably benign Het
Dhx40 A G 11: 86,691,789 (GRCm39) probably null Het
Diaph1 A T 18: 37,989,004 (GRCm39) M910K probably damaging Het
Diras2 T A 13: 52,661,711 (GRCm39) M199L possibly damaging Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Dock5 T A 14: 68,015,052 (GRCm39) Q1302H probably benign Het
Dync1i2 T C 2: 71,058,967 (GRCm39) S90P probably benign Het
E2f8 A T 7: 48,516,943 (GRCm39) V812E probably damaging Het
Egfem1 C A 3: 29,744,323 (GRCm39) Q521K probably damaging Het
Fbxl18 A T 5: 142,864,475 (GRCm39) C699* probably null Het
Fgf3 C T 7: 144,392,520 (GRCm39) R26* probably null Het
Fpr-rs7 T G 17: 20,334,365 (GRCm39) I42L probably benign Het
Gm3159 T A 14: 4,398,582 (GRCm38) M91K probably damaging Het
Gprin3 A G 6: 59,330,877 (GRCm39) S477P possibly damaging Het
Grm8 A T 6: 27,761,203 (GRCm39) probably null Het
Hepacam2 A T 6: 3,466,142 (GRCm39) D420E probably damaging Het
Hmcn1 A T 1: 150,485,529 (GRCm39) W4358R probably benign Het
Ifna6 G A 4: 88,745,956 (GRCm39) A102T probably benign Het
Ighv2-2 T C 12: 113,552,142 (GRCm39) Q32R probably benign Het
Igkv1-131 T A 6: 67,743,242 (GRCm39) Q47L possibly damaging Het
Il16 T C 7: 83,323,761 (GRCm39) E263G probably damaging Het
Kansl1 A T 11: 104,225,974 (GRCm39) C981S probably benign Het
Lrp1 A T 10: 127,410,298 (GRCm39) F1483I probably damaging Het
Ltf T C 9: 110,849,980 (GRCm39) M1T probably null Het
Ly75 C T 2: 60,129,426 (GRCm39) R1653H probably benign Het
Macrod2 T C 2: 142,018,587 (GRCm39) F240S probably damaging Het
Man1c1 T C 4: 134,296,371 (GRCm39) E433G probably damaging Het
Mansc4 A T 6: 146,983,047 (GRCm39) M130K probably benign Het
Mccc1 C T 3: 36,044,197 (GRCm39) probably null Het
Mst1 A G 9: 107,958,485 (GRCm39) D65G probably damaging Het
Myo9b C T 8: 71,796,330 (GRCm39) A857V probably damaging Het
Ndufa4 A G 6: 11,900,574 (GRCm39) V70A probably benign Het
Npat T A 9: 53,466,400 (GRCm39) S230T probably benign Het
Nr1d1 A G 11: 98,662,134 (GRCm39) Y167H probably damaging Het
Oca2 A G 7: 56,064,210 (GRCm39) D735G probably damaging Het
Odr4 G A 1: 150,250,588 (GRCm39) L319F probably damaging Het
Or2a7 T C 6: 43,151,265 (GRCm39) V115A probably benign Het
Or2b2 C T 13: 21,887,393 (GRCm39) T74I probably benign Het
Or2y13 A G 11: 49,414,771 (GRCm39) T74A probably damaging Het
Or7g20 T A 9: 18,946,854 (GRCm39) I145N possibly damaging Het
Otop1 A G 5: 38,457,507 (GRCm39) Y422C probably damaging Het
Pde4dip G A 3: 97,748,964 (GRCm39) R126* probably null Het
Pdp2 C T 8: 105,321,320 (GRCm39) P390S probably damaging Het
Pds5b A T 5: 150,639,926 (GRCm39) T14S possibly damaging Het
Pfkp T C 13: 6,638,631 (GRCm39) E580G probably damaging Het
Piezo2 A T 18: 63,250,767 (GRCm39) L212Q possibly damaging Het
Piezo2 G C 18: 63,250,768 (GRCm39) L444V probably benign Het
Pla2g4d T A 2: 120,109,429 (GRCm39) T207S possibly damaging Het
Plk2 C A 13: 110,535,591 (GRCm39) T471K possibly damaging Het
Potefam1 T C 2: 111,041,910 (GRCm39) T342A probably benign Het
Potegl T A 2: 23,102,730 (GRCm39) L156Q probably damaging Het
Ppp1r3g G A 13: 36,153,245 (GRCm39) E222K probably damaging Het
Pramel28 A T 4: 143,691,708 (GRCm39) D338E possibly damaging Het
Prkcg A G 7: 3,371,974 (GRCm39) D480G probably damaging Het
Pxdc1 T A 13: 34,836,178 (GRCm39) T81S probably benign Het
Rnf150 A T 8: 83,730,228 (GRCm39) K253* probably null Het
Sae1 T C 7: 16,104,387 (GRCm39) probably null Het
Scin C T 12: 40,113,258 (GRCm39) D538N probably damaging Het
Serpinb3c C A 1: 107,199,533 (GRCm39) K329N probably damaging Het
Sgo2b T A 8: 64,380,008 (GRCm39) K941N possibly damaging Het
Six1 C T 12: 73,093,058 (GRCm39) S48N possibly damaging Het
Slc39a8 G A 3: 135,590,449 (GRCm39) G381R probably damaging Het
Slc9b1 A G 3: 135,063,320 (GRCm39) K35E unknown Het
Srek1 C T 13: 103,895,752 (GRCm39) A274T probably damaging Het
Steap2 A T 5: 5,727,497 (GRCm39) Y279* probably null Het
Svil T A 18: 5,046,823 (GRCm39) L110* probably null Het
Syncrip T C 9: 88,338,762 (GRCm39) probably benign Het
Tcf20 A G 15: 82,737,443 (GRCm39) I1336T probably benign Het
Tecpr1 T A 5: 144,155,451 (GRCm39) K36* probably null Het
Tenm2 A G 11: 36,032,510 (GRCm39) V670A probably damaging Het
Thbd G A 2: 148,249,286 (GRCm39) T194I probably damaging Het
Tm9sf2 A T 14: 122,389,374 (GRCm39) probably null Het
Tmtc4 A T 14: 123,187,911 (GRCm39) I225N probably damaging Het
Tpp1 C T 7: 105,396,743 (GRCm39) V425M probably damaging Het
Trbc2 T A 6: 41,524,746 (GRCm39) Y144* probably null Het
Trps1 T C 15: 50,709,504 (GRCm39) D282G probably damaging Het
Tsc22d4 T A 5: 137,745,404 (GRCm39) S9R probably damaging Het
Upp1 T A 11: 9,086,025 (GRCm39) D287E probably benign Het
Uso1 A C 5: 92,349,158 (GRCm39) Q916H probably damaging Het
Uty T A Y: 1,134,902 (GRCm39) Y884F probably damaging Het
Vmn1r222 T C 13: 23,416,950 (GRCm39) R88G probably damaging Het
Vmn1r79 T C 7: 11,910,928 (GRCm39) V270A possibly damaging Het
Zbtb22 T C 17: 34,136,709 (GRCm39) S285P probably benign Het
Zfp385a A G 15: 103,226,492 (GRCm39) V82A probably damaging Het
Zfp59 T C 7: 27,553,594 (GRCm39) F349L probably benign Het
Zfp780b T G 7: 27,662,224 (GRCm39) H777P probably benign Het
Zfp82 T C 7: 29,756,549 (GRCm39) T178A probably benign Het
Zfp850 T C 7: 27,688,513 (GRCm39) Y565C probably damaging Het
Zfp957 A G 14: 79,450,207 (GRCm39) Y531H probably damaging Het
Other mutations in Mink1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Mink1 APN 11 70,494,638 (GRCm39) missense probably damaging 0.99
IGL00709:Mink1 APN 11 70,503,845 (GRCm39) missense probably damaging 0.99
IGL01064:Mink1 APN 11 70,494,307 (GRCm39) missense probably benign 0.05
IGL02612:Mink1 APN 11 70,488,052 (GRCm39) missense probably damaging 1.00
IGL02797:Mink1 APN 11 70,501,176 (GRCm39) missense probably damaging 1.00
IGL03056:Mink1 APN 11 70,503,409 (GRCm39) critical splice donor site probably null
IGL03066:Mink1 APN 11 70,499,715 (GRCm39) missense probably benign 0.01
IGL03185:Mink1 APN 11 70,494,686 (GRCm39) missense probably damaging 1.00
PIT4498001:Mink1 UTSW 11 70,489,714 (GRCm39) missense probably benign 0.05
R0025:Mink1 UTSW 11 70,503,868 (GRCm39) missense probably damaging 1.00
R0025:Mink1 UTSW 11 70,503,868 (GRCm39) missense probably damaging 1.00
R0488:Mink1 UTSW 11 70,488,030 (GRCm39) missense probably damaging 1.00
R0637:Mink1 UTSW 11 70,492,502 (GRCm39) missense probably damaging 0.96
R0828:Mink1 UTSW 11 70,500,971 (GRCm39) nonsense probably null
R1081:Mink1 UTSW 11 70,497,861 (GRCm39) missense probably benign 0.07
R1175:Mink1 UTSW 11 70,502,166 (GRCm39) missense probably benign 0.02
R1441:Mink1 UTSW 11 70,497,940 (GRCm39) missense possibly damaging 0.72
R1532:Mink1 UTSW 11 70,492,833 (GRCm39) missense probably null 1.00
R1545:Mink1 UTSW 11 70,489,717 (GRCm39) missense possibly damaging 0.60
R1634:Mink1 UTSW 11 70,499,706 (GRCm39) missense probably benign 0.00
R1932:Mink1 UTSW 11 70,499,254 (GRCm39) critical splice donor site probably null
R2033:Mink1 UTSW 11 70,503,334 (GRCm39) missense probably damaging 1.00
R2184:Mink1 UTSW 11 70,494,623 (GRCm39) missense probably damaging 1.00
R2267:Mink1 UTSW 11 70,492,550 (GRCm39) splice site probably null
R2268:Mink1 UTSW 11 70,492,550 (GRCm39) splice site probably null
R2859:Mink1 UTSW 11 70,503,334 (GRCm39) missense probably damaging 1.00
R3713:Mink1 UTSW 11 70,499,776 (GRCm39) missense possibly damaging 0.93
R3714:Mink1 UTSW 11 70,499,776 (GRCm39) missense possibly damaging 0.93
R3715:Mink1 UTSW 11 70,499,776 (GRCm39) missense possibly damaging 0.93
R3716:Mink1 UTSW 11 70,498,587 (GRCm39) missense probably damaging 0.98
R3717:Mink1 UTSW 11 70,498,587 (GRCm39) missense probably damaging 0.98
R4607:Mink1 UTSW 11 70,496,893 (GRCm39) missense possibly damaging 0.72
R4735:Mink1 UTSW 11 70,500,086 (GRCm39) splice site probably null
R4790:Mink1 UTSW 11 70,489,867 (GRCm39) missense probably damaging 0.99
R4847:Mink1 UTSW 11 70,492,854 (GRCm39) missense probably damaging 1.00
R4860:Mink1 UTSW 11 70,502,418 (GRCm39) missense probably damaging 0.98
R4860:Mink1 UTSW 11 70,502,418 (GRCm39) missense probably damaging 0.98
R5081:Mink1 UTSW 11 70,495,970 (GRCm39) missense probably damaging 0.98
R5310:Mink1 UTSW 11 70,498,169 (GRCm39) missense probably benign 0.33
R5767:Mink1 UTSW 11 70,496,901 (GRCm39) missense possibly damaging 0.53
R5795:Mink1 UTSW 11 70,498,616 (GRCm39) missense possibly damaging 0.86
R5888:Mink1 UTSW 11 70,500,885 (GRCm39) unclassified probably benign
R5950:Mink1 UTSW 11 70,500,412 (GRCm39) missense possibly damaging 0.81
R6024:Mink1 UTSW 11 70,489,915 (GRCm39) missense possibly damaging 0.71
R6034:Mink1 UTSW 11 70,497,866 (GRCm39) small deletion probably benign
R6034:Mink1 UTSW 11 70,497,866 (GRCm39) small deletion probably benign
R6058:Mink1 UTSW 11 70,502,546 (GRCm39) missense possibly damaging 0.96
R6144:Mink1 UTSW 11 70,501,478 (GRCm39) missense possibly damaging 0.66
R6154:Mink1 UTSW 11 70,500,927 (GRCm39) missense possibly damaging 0.46
R6218:Mink1 UTSW 11 70,489,720 (GRCm39) missense possibly damaging 0.94
R6262:Mink1 UTSW 11 70,494,151 (GRCm39) splice site probably null
R6269:Mink1 UTSW 11 70,489,813 (GRCm39) missense probably damaging 1.00
R6273:Mink1 UTSW 11 70,502,261 (GRCm39) nonsense probably null
R6301:Mink1 UTSW 11 70,503,120 (GRCm39) missense possibly damaging 0.71
R6603:Mink1 UTSW 11 70,500,419 (GRCm39) missense probably damaging 0.96
R6876:Mink1 UTSW 11 70,498,261 (GRCm39) missense probably benign 0.02
R7030:Mink1 UTSW 11 70,498,601 (GRCm39) missense possibly damaging 0.46
R7050:Mink1 UTSW 11 70,503,158 (GRCm39) missense possibly damaging 0.93
R7094:Mink1 UTSW 11 70,500,901 (GRCm39) splice site probably null
R7135:Mink1 UTSW 11 70,494,329 (GRCm39) missense probably damaging 1.00
R7238:Mink1 UTSW 11 70,502,305 (GRCm39) critical splice donor site probably null
R7320:Mink1 UTSW 11 70,489,899 (GRCm39) missense probably benign 0.23
R7396:Mink1 UTSW 11 70,495,994 (GRCm39) missense possibly damaging 0.73
R7446:Mink1 UTSW 11 70,500,455 (GRCm39) missense probably benign 0.18
R7723:Mink1 UTSW 11 70,503,736 (GRCm39) missense probably benign 0.16
R7896:Mink1 UTSW 11 70,503,108 (GRCm39) missense possibly damaging 0.71
R8058:Mink1 UTSW 11 70,494,594 (GRCm39) nonsense probably null
R8082:Mink1 UTSW 11 70,504,103 (GRCm39) missense possibly damaging 0.71
R8160:Mink1 UTSW 11 70,496,907 (GRCm39) nonsense probably null
R8335:Mink1 UTSW 11 70,500,401 (GRCm39) missense probably damaging 0.97
R8353:Mink1 UTSW 11 70,501,154 (GRCm39) missense possibly damaging 0.70
R8453:Mink1 UTSW 11 70,501,154 (GRCm39) missense possibly damaging 0.70
R8732:Mink1 UTSW 11 70,500,902 (GRCm39) critical splice acceptor site probably null
R9072:Mink1 UTSW 11 70,499,207 (GRCm39) missense possibly damaging 0.86
R9073:Mink1 UTSW 11 70,499,207 (GRCm39) missense possibly damaging 0.86
R9324:Mink1 UTSW 11 70,502,477 (GRCm39) missense probably damaging 0.98
R9596:Mink1 UTSW 11 70,497,915 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATCATGAATGTGCCCGGTG -3'
(R):5'- TGTCAACCTTTGGCCAACAG -3'

Sequencing Primer
(F):5'- ATGAATGTGCCCGGTGAGTCC -3'
(R):5'- CAGAAAAGCAACCTTTGGCTTTGG -3'
Posted On 2016-11-09