Mutagenetix > Incidental Mutation

Incidental Mutation 'R5677:Kansl1'

442829

Institutional Source

Beutler Lab

Gene Symbol

Kansl1

Ensembl Gene

ENSMUSG00000018412

Gene Name

KAT8 regulatory NSL complex subunit 1

Synonyms

1700081L11Rik

MMRRC Submission

043316-MU

Accession Numbers

Genbank: NM_001081045.1; Ensembl: ENSMUST00000018556, ENSMUST00000035872, ENSMUST00000106971, ENSMUST00000106972, ENSMUST00000106974, ENSMUST00000106977, ENSMUST00000134266, ENSMUST00000166536

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5677 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104333229-104468861 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104335148 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 981 (C981S)

Ref Sequence

ENSEMBL: ENSMUSP00000102590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977] [ENSMUST00000106992]

AlphaFold

Q80TG1

Predicted Effect

probably benign
Transcript: ENSMUST00000018556
AA Change: C981S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412
AA Change: C981S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	759	772	N/A	INTRINSIC
PEHE	816	966	1.53e-53	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000069188

Predicted Effect

probably benign
Transcript: ENSMUST00000106971
AA Change: C1044S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: C1044S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	822	835	N/A	INTRINSIC
PEHE	879	1029	1.53e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106972
AA Change: C1044S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: C1044S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	822	835	N/A	INTRINSIC
PEHE	879	1029	1.53e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106977
AA Change: C981S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412
AA Change: C981S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	759	772	N/A	INTRINSIC
PEHE	816	966	1.53e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106992

SMART Domains

Protein: ENSMUSP00000102605
Gene: ENSMUSG00000018411

Domain	Start	End	E-Value	Type
low complexity region	69	81	N/A	INTRINSIC
low complexity region	105	154	N/A	INTRINSIC
Pfam:Tubulin-binding	174	205	6.1e-19	PFAM
Pfam:Tubulin-binding	206	236	1.5e-21	PFAM
Pfam:Tubulin-binding	237	267	6.9e-20	PFAM
Pfam:Tubulin-binding	268	299	4.7e-19	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]

Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock

Total: 116 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	C	T	10: 28,986,229	V22I	probably benign	Het
4930430A15Rik	T	C	2: 111,211,565	T342A	probably benign	Het
4931423N10Rik	T	A	2: 23,212,718	L156Q	probably damaging	Het
Abca8a	A	T	11: 110,038,399	V1296D	possibly damaging	Het
Abca8b	C	T	11: 109,940,861	S1328N	probably damaging	Het
Adcy1	G	A	11: 7,161,914	M926I	probably damaging	Het
Aff4	G	T	11: 53,400,275	M687I	possibly damaging	Het
Agbl2	T	A	2: 90,807,978	Y636N	possibly damaging	Het
Agtr1a	A	T	13: 30,381,584	I211F	probably damaging	Het
Alkbh8	T	G	9: 3,385,147	S480A	possibly damaging	Het
Ankrd13b	A	T	11: 77,477,544	V84E	probably damaging	Het
Ap3b1	C	T	13: 94,528,196	T881I	unknown	Het
Apbb1	A	C	7: 105,559,246	D617E	probably damaging	Het
Apobec4	A	G	1: 152,757,282	R354G	probably benign	Het
BC003331	G	A	1: 150,374,837	L319F	probably damaging	Het
Brdt	T	G	5: 107,348,617	C198W	possibly damaging	Het
Cacna1b	G	T	2: 24,679,358	H851Q	possibly damaging	Het
Car2	G	T	3: 14,898,055	V217F	possibly damaging	Het
Ccdc24	A	C	4: 117,869,880		probably benign	Het
Chodl	C	A	16: 78,941,315	A57E	probably damaging	Het
Clgn	G	T	8: 83,409,538	C185F	probably damaging	Het
Cltc	G	T	11: 86,705,242	N1223K	probably damaging	Het
Cnot10	T	C	9: 114,629,093	N115S	probably damaging	Het
Col12a1	T	C	9: 79,699,321	R607G	probably damaging	Het
Cpd	A	G	11: 76,799,825	V835A	probably benign	Het
Csmd3	G	C	15: 48,622,051	L153V	probably damaging	Het
Ctr9	A	G	7: 111,044,002	H527R	probably benign	Het
Cwc22	G	A	2: 77,929,443	R87W	probably damaging	Het
D930020B18Rik	T	A	10: 121,669,201	N107K	probably benign	Het
Dgkg	C	A	16: 22,570,171	V418L	probably benign	Het
Dhx40	A	G	11: 86,800,963		probably null	Het
Diaph1	A	T	18: 37,855,951	M910K	probably damaging	Het
Diras2	T	A	13: 52,507,675	M199L	possibly damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dock5	T	A	14: 67,777,603	Q1302H	probably benign	Het
Dync1i2	T	C	2: 71,228,623	S90P	probably benign	Het
E2f8	A	T	7: 48,867,195	V812E	probably damaging	Het
Egfem1	C	A	3: 29,690,174	Q521K	probably damaging	Het
Fbxl18	A	T	5: 142,878,720	C699*	probably null	Het
Fgf3	C	T	7: 144,838,783	R26*	probably null	Het
Fpr-rs7	T	G	17: 20,114,103	I42L	probably benign	Het
Gm13101	A	T	4: 143,965,138	D338E	possibly damaging	Het
Gm3159	T	A	14: 4,398,582	M91K	probably damaging	Het
Gprin3	A	G	6: 59,353,892	S477P	possibly damaging	Het
Grm8	A	T	6: 27,761,204		probably null	Het
Hepacam2	A	T	6: 3,466,142	D420E	probably damaging	Het
Hmcn1	A	T	1: 150,609,778	W4358R	probably benign	Het
Ifna6	G	A	4: 88,827,719	A102T	probably benign	Het
Ighv2-2	T	C	12: 113,588,522	Q32R	probably benign	Het
Igkv1-131	T	A	6: 67,766,258	Q47L	possibly damaging	Het
Il16	T	C	7: 83,674,553	E263G	probably damaging	Het
Lrp1	A	T	10: 127,574,429	F1483I	probably damaging	Het
Ltf	T	C	9: 111,020,912	M1T	probably null	Het
Ly75	C	T	2: 60,299,082	R1653H	probably benign	Het
Macrod2	T	C	2: 142,176,667	F240S	probably damaging	Het
Man1c1	T	C	4: 134,569,060	E433G	probably damaging	Het
Mansc4	A	T	6: 147,081,549	M130K	probably benign	Het
Mccc1	C	T	3: 35,990,048		probably null	Het
Mink1	G	T	11: 70,605,165	R75L	possibly damaging	Het
Mst1	A	G	9: 108,081,286	D65G	probably damaging	Het
Myo9b	C	T	8: 71,343,686	A857V	probably damaging	Het
Ndufa4	A	G	6: 11,900,575	V70A	probably benign	Het
Npat	T	A	9: 53,555,100	S230T	probably benign	Het
Nr1d1	A	G	11: 98,771,308	Y167H	probably damaging	Het
Oca2	A	G	7: 56,414,462	D735G	probably damaging	Het
Olfr13	T	C	6: 43,174,331	V115A	probably benign	Het
Olfr1359	C	T	13: 21,703,223	T74I	probably benign	Het
Olfr1383	A	G	11: 49,523,944	T74A	probably damaging	Het
Olfr835	T	A	9: 19,035,558	I145N	possibly damaging	Het
Otop1	A	G	5: 38,300,163	Y422C	probably damaging	Het
Pde4dip	G	A	3: 97,841,648	R126*	probably null	Het
Pdp2	C	T	8: 104,594,688	P390S	probably damaging	Het
Pds5b	A	T	5: 150,716,461	T14S	possibly damaging	Het
Pfkp	T	C	13: 6,588,595	E580G	probably damaging	Het
Piezo2	A	T	18: 63,117,696	L212Q	possibly damaging	Het
Piezo2	G	C	18: 63,117,697	L444V	probably benign	Het
Pla2g4d	T	A	2: 120,278,948	T207S	possibly damaging	Het
Plk2	C	A	13: 110,399,057	T471K	possibly damaging	Het
Ppp1r3g	G	A	13: 35,969,262	E222K	probably damaging	Het
Prkcg	A	G	7: 3,323,458	D480G	probably damaging	Het
Pxdc1	T	A	13: 34,652,195	T81S	probably benign	Het
Rnf150	A	T	8: 83,003,599	K253*	probably null	Het
Rsg1	C	T	4: 141,219,866	P186L	probably benign	Het
Sae1	T	C	7: 16,370,462		probably null	Het
Scin	C	T	12: 40,063,259	D538N	probably damaging	Het
Serpinb3c	C	A	1: 107,271,803	K329N	probably damaging	Het
Sgo2b	T	A	8: 63,926,974	K941N	possibly damaging	Het
Six1	C	T	12: 73,046,284	S48N	possibly damaging	Het
Slc39a8	G	A	3: 135,884,688	G381R	probably damaging	Het
Slc9b1	A	G	3: 135,357,559	K35E	unknown	Het
Srek1	C	T	13: 103,759,244	A274T	probably damaging	Het
Steap2	A	T	5: 5,677,497	Y279*	probably null	Het
Svil	T	A	18: 5,046,823	L110*	probably null	Het
Syncrip	T	C	9: 88,456,709		probably benign	Het
Tcf20	A	G	15: 82,853,242	I1336T	probably benign	Het
Tecpr1	T	A	5: 144,218,633	K36*	probably null	Het
Tenm2	A	G	11: 36,141,683	V670A	probably damaging	Het
Thbd	G	A	2: 148,407,366	T194I	probably damaging	Het
Tm9sf2	A	T	14: 122,151,962		probably null	Het
Tmtc4	A	T	14: 122,950,499	I225N	probably damaging	Het
Tpp1	C	T	7: 105,747,536	V425M	probably damaging	Het
Trbc2	T	A	6: 41,547,812	Y144*	probably null	Het
Trps1	T	C	15: 50,846,108	D282G	probably damaging	Het
Tsc22d4	T	A	5: 137,747,142	S9R	probably damaging	Het
Upp1	T	A	11: 9,136,025	D287E	probably benign	Het
Uso1	A	C	5: 92,201,299	Q916H	probably damaging	Het
Uty	T	A	Y: 1,134,902	Y884F	probably damaging	Het
Vmn1r222	T	C	13: 23,232,780	R88G	probably damaging	Het
Vmn1r79	T	C	7: 12,177,001	V270A	possibly damaging	Het
Zbtb22	T	C	17: 33,917,735	S285P	probably benign	Het
Zfp385a	A	G	15: 103,318,065	V82A	probably damaging	Het
Zfp59	T	C	7: 27,854,169	F349L	probably benign	Het
Zfp780b	T	G	7: 27,962,799	H777P	probably benign	Het
Zfp82	T	C	7: 30,057,124	T178A	probably benign	Het
Zfp850	T	C	7: 27,989,088	Y565C	probably damaging	Het
Zfp957	A	G	14: 79,212,767	Y531H	probably damaging	Het

Other mutations in Kansl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Kansl1	APN	11	104424466	missense	probably damaging	0.96
IGL00658:Kansl1	APN	11	104357526	missense	probably benign	0.10
IGL00688:Kansl1	APN	11	104425066	missense	probably damaging	1.00
IGL01121:Kansl1	APN	11	104335596	missense	probably benign	0.01
IGL01624:Kansl1	APN	11	104424552	missense	probably benign	0.13
IGL02187:Kansl1	APN	11	104378831	splice site	probably null
IGL02711:Kansl1	APN	11	104335575	missense	probably damaging	1.00
IGL02965:Kansl1	APN	11	104335165	missense	probably damaging	0.99
kansas	UTSW	11	104424132	missense	possibly damaging	0.94
wichita	UTSW	11	104356767	missense	possibly damaging	0.90
NA:Kansl1	UTSW	11	104342367	missense	probably benign	0.09
R0399:Kansl1	UTSW	11	104424132	missense	possibly damaging	0.94
R0611:Kansl1	UTSW	11	104338186	missense	probably benign	0.31
R0665:Kansl1	UTSW	11	104343538	missense	probably benign
R0667:Kansl1	UTSW	11	104343538	missense	probably benign
R0747:Kansl1	UTSW	11	104342976	missense	probably benign	0.00
R0865:Kansl1	UTSW	11	104424368	missense	probably benign	0.08
R1479:Kansl1	UTSW	11	104342416	missense	probably damaging	1.00
R1679:Kansl1	UTSW	11	104423996	missense	probably damaging	1.00
R1818:Kansl1	UTSW	11	104342457	missense	possibly damaging	0.80
R1922:Kansl1	UTSW	11	104343640	missense	probably damaging	1.00
R1932:Kansl1	UTSW	11	104335097	missense	probably damaging	0.99
R2105:Kansl1	UTSW	11	104335559	missense	probably damaging	0.98
R2907:Kansl1	UTSW	11	104424460	missense	possibly damaging	0.82
R3935:Kansl1	UTSW	11	104343543	missense	possibly damaging	0.83
R3936:Kansl1	UTSW	11	104343543	missense	possibly damaging	0.83
R4282:Kansl1	UTSW	11	104378689	missense	probably benign	0.19
R4455:Kansl1	UTSW	11	104424358	missense	possibly damaging	0.47
R4696:Kansl1	UTSW	11	104356767	missense	possibly damaging	0.90
R4846:Kansl1	UTSW	11	104342972	missense	possibly damaging	0.48
R4890:Kansl1	UTSW	11	104343042	missense	probably benign
R4973:Kansl1	UTSW	11	104424321	missense	probably damaging	1.00
R4975:Kansl1	UTSW	11	104335564	missense	probably damaging	1.00
R5085:Kansl1	UTSW	11	104424342	missense	probably damaging	1.00
R5227:Kansl1	UTSW	11	104356814	missense	probably benign	0.19
R5310:Kansl1	UTSW	11	104424858	missense	possibly damaging	0.95
R5652:Kansl1	UTSW	11	104338166	missense	probably damaging	1.00
R5980:Kansl1	UTSW	11	104343637	missense	possibly damaging	0.96
R6013:Kansl1	UTSW	11	104350639	missense	probably benign	0.00
R6253:Kansl1	UTSW	11	104357526	missense	probably benign	0.10
R7751:Kansl1	UTSW	11	104424064	missense	probably benign	0.30
R7880:Kansl1	UTSW	11	104424153	missense	probably damaging	1.00
R7888:Kansl1	UTSW	11	104342422	missense	probably benign	0.00
R7935:Kansl1	UTSW	11	104424286	missense	probably damaging	0.99
R8251:Kansl1	UTSW	11	104424360	missense	probably benign
R9033:Kansl1	UTSW	11	104357530	missense	probably benign	0.00
R9192:Kansl1	UTSW	11	104336316	missense	probably damaging	1.00
R9494:Kansl1	UTSW	11	104356740	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GAGTCTGTATAGTCTCATTTTCCGC -3'
(R):5'- GTGCCGAAGATAAAGCTCTTC -3'

Sequencing Primer
(F):5'- CTCATCTGTGAGCTGGGC -3'
(R):5'- GCCGAAGATAAAGCTCTTCTCTCTG -3'

Posted On

2016-11-09