Incidental Mutation 'R5677:Svil'
ID442859
Institutional Source Beutler Lab
Gene Symbol Svil
Ensembl Gene ENSMUSG00000024236
Gene Namesupervillin
SynonymsB430302E16Rik
MMRRC Submission 043316-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R5677 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location4920540-5119299 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 5046823 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 110 (L110*)
Ref Sequence ENSEMBL: ENSMUSP00000147843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025079] [ENSMUST00000126977] [ENSMUST00000127297] [ENSMUST00000131609] [ENSMUST00000140448] [ENSMUST00000143254] [ENSMUST00000153016] [ENSMUST00000210707]
Predicted Effect probably null
Transcript: ENSMUST00000025079
AA Change: L23*
SMART Domains Protein: ENSMUSP00000025079
Gene: ENSMUSG00000024236
AA Change: L23*

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126977
AA Change: L23*
SMART Domains Protein: ENSMUSP00000115078
Gene: ENSMUSG00000024236
AA Change: L23*

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127297
AA Change: L23*
SMART Domains Protein: ENSMUSP00000115223
Gene: ENSMUSG00000024236
AA Change: L23*

DomainStartEndE-ValueType
low complexity region 1067 1077 N/A INTRINSIC
GEL 1283 1382 4.58e-22 SMART
GEL 1407 1524 4.03e-1 SMART
GEL 1594 1704 2.93e-20 SMART
low complexity region 1711 1717 N/A INTRINSIC
GEL 1723 1824 1.72e-17 SMART
GEL 1857 1964 1.37e0 SMART
VHP 2021 2056 1.15e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131210
Predicted Effect probably null
Transcript: ENSMUST00000131609
AA Change: L23*
SMART Domains Protein: ENSMUSP00000122242
Gene: ENSMUSG00000024236
AA Change: L23*

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 2.9e-24 SMART
GEL 1521 1638 2.5e-3 SMART
GEL 1708 1818 1.9e-22 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.1e-19 SMART
low complexity region 1965 1974 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138258
Predicted Effect probably null
Transcript: ENSMUST00000140448
AA Change: L23*
SMART Domains Protein: ENSMUSP00000119803
Gene: ENSMUSG00000024236
AA Change: L23*

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000143254
AA Change: L23*
SMART Domains Protein: ENSMUSP00000119287
Gene: ENSMUSG00000024236
AA Change: L23*

DomainStartEndE-ValueType
low complexity region 777 787 N/A INTRINSIC
GEL 993 1092 4.58e-22 SMART
GEL 1117 1234 4.03e-1 SMART
GEL 1304 1414 2.93e-20 SMART
low complexity region 1421 1427 N/A INTRINSIC
GEL 1433 1534 1.72e-17 SMART
GEL 1567 1674 1.37e0 SMART
VHP 1731 1766 1.15e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000153016
AA Change: L23*
Predicted Effect probably null
Transcript: ENSMUST00000210707
AA Change: L110*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bipartite protein with distinct amino- and carboxy-terminal domains. The amino-terminus contains nuclear localization signals and the carboxy-terminus contains numerous consecutive sequences with extensive similarity to proteins in the gelsolin family of actin-binding proteins, which cap, nucleate, and/or sever actin filaments. The gene product is tightly associated with both actin filaments and plasma membranes, suggesting a role as a high-affinity link between the actin cytoskeleton and the membrane. The encoded protein appears to aid in both myosin II assembly during cell spreading and disassembly of focal adhesions. Several transcript variants encoding different isoforms of supervillin have been described. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanched adhesion and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik C T 10: 28,986,229 V22I probably benign Het
4930430A15Rik T C 2: 111,211,565 T342A probably benign Het
4931423N10Rik T A 2: 23,212,718 L156Q probably damaging Het
Abca8a A T 11: 110,038,399 V1296D possibly damaging Het
Abca8b C T 11: 109,940,861 S1328N probably damaging Het
Adcy1 G A 11: 7,161,914 M926I probably damaging Het
Aff4 G T 11: 53,400,275 M687I possibly damaging Het
Agbl2 T A 2: 90,807,978 Y636N possibly damaging Het
Agtr1a A T 13: 30,381,584 I211F probably damaging Het
Alkbh8 T G 9: 3,385,147 S480A possibly damaging Het
Ankrd13b A T 11: 77,477,544 V84E probably damaging Het
Ap3b1 C T 13: 94,528,196 T881I unknown Het
Apbb1 A C 7: 105,559,246 D617E probably damaging Het
Apobec4 A G 1: 152,757,282 R354G probably benign Het
BC003331 G A 1: 150,374,837 L319F probably damaging Het
Brdt T G 5: 107,348,617 C198W possibly damaging Het
Cacna1b G T 2: 24,679,358 H851Q possibly damaging Het
Car2 G T 3: 14,898,055 V217F possibly damaging Het
Ccdc24 A C 4: 117,869,880 probably benign Het
Chodl C A 16: 78,941,315 A57E probably damaging Het
Clgn G T 8: 83,409,538 C185F probably damaging Het
Cltc G T 11: 86,705,242 N1223K probably damaging Het
Cnot10 T C 9: 114,629,093 N115S probably damaging Het
Col12a1 T C 9: 79,699,321 R607G probably damaging Het
Cpd A G 11: 76,799,825 V835A probably benign Het
Csmd3 G C 15: 48,622,051 L153V probably damaging Het
Ctr9 A G 7: 111,044,002 H527R probably benign Het
Cwc22 G A 2: 77,929,443 R87W probably damaging Het
D930020B18Rik T A 10: 121,669,201 N107K probably benign Het
Dgkg C A 16: 22,570,171 V418L probably benign Het
Dhx40 A G 11: 86,800,963 probably null Het
Diaph1 A T 18: 37,855,951 M910K probably damaging Het
Diras2 T A 13: 52,507,675 M199L possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock5 T A 14: 67,777,603 Q1302H probably benign Het
Dync1i2 T C 2: 71,228,623 S90P probably benign Het
E2f8 A T 7: 48,867,195 V812E probably damaging Het
Egfem1 C A 3: 29,690,174 Q521K probably damaging Het
Fbxl18 A T 5: 142,878,720 C699* probably null Het
Fgf3 C T 7: 144,838,783 R26* probably null Het
Fpr-rs7 T G 17: 20,114,103 I42L probably benign Het
Gm13101 A T 4: 143,965,138 D338E possibly damaging Het
Gm3159 T A 14: 4,398,582 M91K probably damaging Het
Gprin3 A G 6: 59,353,892 S477P possibly damaging Het
Grm8 A T 6: 27,761,204 probably null Het
Hepacam2 A T 6: 3,466,142 D420E probably damaging Het
Hmcn1 A T 1: 150,609,778 W4358R probably benign Het
Ifna6 G A 4: 88,827,719 A102T probably benign Het
Ighv2-2 T C 12: 113,588,522 Q32R probably benign Het
Igkv1-131 T A 6: 67,766,258 Q47L possibly damaging Het
Il16 T C 7: 83,674,553 E263G probably damaging Het
Kansl1 A T 11: 104,335,148 C981S probably benign Het
Lrp1 A T 10: 127,574,429 F1483I probably damaging Het
Ltf T C 9: 111,020,912 M1T probably null Het
Ly75 C T 2: 60,299,082 R1653H probably benign Het
Macrod2 T C 2: 142,176,667 F240S probably damaging Het
Man1c1 T C 4: 134,569,060 E433G probably damaging Het
Mansc4 A T 6: 147,081,549 M130K probably benign Het
Mccc1 C T 3: 35,990,048 probably null Het
Mink1 G T 11: 70,605,165 R75L possibly damaging Het
Mst1 A G 9: 108,081,286 D65G probably damaging Het
Myo9b C T 8: 71,343,686 A857V probably damaging Het
Ndufa4 A G 6: 11,900,575 V70A probably benign Het
Npat T A 9: 53,555,100 S230T probably benign Het
Nr1d1 A G 11: 98,771,308 Y167H probably damaging Het
Oca2 A G 7: 56,414,462 D735G probably damaging Het
Olfr13 T C 6: 43,174,331 V115A probably benign Het
Olfr1359 C T 13: 21,703,223 T74I probably benign Het
Olfr1383 A G 11: 49,523,944 T74A probably damaging Het
Olfr835 T A 9: 19,035,558 I145N possibly damaging Het
Otop1 A G 5: 38,300,163 Y422C probably damaging Het
Pde4dip G A 3: 97,841,648 R126* probably null Het
Pdp2 C T 8: 104,594,688 P390S probably damaging Het
Pds5b A T 5: 150,716,461 T14S possibly damaging Het
Pfkp T C 13: 6,588,595 E580G probably damaging Het
Piezo2 A T 18: 63,117,696 L212Q possibly damaging Het
Piezo2 G C 18: 63,117,697 L444V probably benign Het
Pla2g4d T A 2: 120,278,948 T207S possibly damaging Het
Plk2 C A 13: 110,399,057 T471K possibly damaging Het
Ppp1r3g G A 13: 35,969,262 E222K probably damaging Het
Prkcg A G 7: 3,323,458 D480G probably damaging Het
Pxdc1 T A 13: 34,652,195 T81S probably benign Het
Rnf150 A T 8: 83,003,599 K253* probably null Het
Rsg1 C T 4: 141,219,866 P186L probably benign Het
Sae1 T C 7: 16,370,462 probably null Het
Scin C T 12: 40,063,259 D538N probably damaging Het
Serpinb3c C A 1: 107,271,803 K329N probably damaging Het
Sgo2b T A 8: 63,926,974 K941N possibly damaging Het
Six1 C T 12: 73,046,284 S48N possibly damaging Het
Slc39a8 G A 3: 135,884,688 G381R probably damaging Het
Slc9b1 A G 3: 135,357,559 K35E unknown Het
Srek1 C T 13: 103,759,244 A274T probably damaging Het
Steap2 A T 5: 5,677,497 Y279* probably null Het
Syncrip T C 9: 88,456,709 probably benign Het
Tcf20 A G 15: 82,853,242 I1336T probably benign Het
Tecpr1 T A 5: 144,218,633 K36* probably null Het
Tenm2 A G 11: 36,141,683 V670A probably damaging Het
Thbd G A 2: 148,407,366 T194I probably damaging Het
Tm9sf2 A T 14: 122,151,962 probably null Het
Tmtc4 A T 14: 122,950,499 I225N probably damaging Het
Tpp1 C T 7: 105,747,536 V425M probably damaging Het
Trbc2 T A 6: 41,547,812 Y144* probably null Het
Trps1 T C 15: 50,846,108 D282G probably damaging Het
Tsc22d4 T A 5: 137,747,142 S9R probably damaging Het
Upp1 T A 11: 9,136,025 D287E probably benign Het
Uso1 A C 5: 92,201,299 Q916H probably damaging Het
Uty T A Y: 1,134,902 Y884F probably damaging Het
Vmn1r222 T C 13: 23,232,780 R88G probably damaging Het
Vmn1r79 T C 7: 12,177,001 V270A possibly damaging Het
Zbtb22 T C 17: 33,917,735 S285P probably benign Het
Zfp385a A G 15: 103,318,065 V82A probably damaging Het
Zfp59 T C 7: 27,854,169 F349L probably benign Het
Zfp780b T G 7: 27,962,799 H777P probably benign Het
Zfp82 T C 7: 30,057,124 T178A probably benign Het
Zfp850 T C 7: 27,989,088 Y565C probably damaging Het
Zfp957 A G 14: 79,212,767 Y531H probably damaging Het
Other mutations in Svil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Svil APN 18 5099045 missense probably benign 0.27
IGL00840:Svil APN 18 5063555 missense probably benign
IGL01329:Svil APN 18 5064501 missense probably benign
IGL01446:Svil APN 18 5062385 missense probably damaging 1.00
IGL02068:Svil APN 18 5092899 missense probably damaging 1.00
IGL02223:Svil APN 18 5105879 splice site probably benign
IGL02428:Svil APN 18 5118203 missense probably damaging 1.00
IGL02429:Svil APN 18 5118369 missense probably benign 0.00
IGL02479:Svil APN 18 5099476 missense probably damaging 1.00
IGL02560:Svil APN 18 5049379 missense probably benign 0.00
IGL02652:Svil APN 18 5114531 missense probably damaging 1.00
IGL03291:Svil APN 18 5056150 nonsense probably null
IGL03055:Svil UTSW 18 5108615 missense probably damaging 1.00
R0029:Svil UTSW 18 5063286 missense probably benign 0.14
R0029:Svil UTSW 18 5063286 missense probably benign 0.14
R0266:Svil UTSW 18 5099063 splice site probably benign
R0281:Svil UTSW 18 5094582 missense probably damaging 1.00
R0442:Svil UTSW 18 5046870 missense probably damaging 1.00
R0549:Svil UTSW 18 5064566 missense possibly damaging 0.79
R0617:Svil UTSW 18 5117002 missense probably damaging 1.00
R0801:Svil UTSW 18 5099443 missense probably benign 0.00
R0894:Svil UTSW 18 5097494 missense probably damaging 1.00
R1053:Svil UTSW 18 5056690 missense probably benign 0.16
R1065:Svil UTSW 18 5063777 splice site probably benign
R1080:Svil UTSW 18 5058147 missense possibly damaging 0.79
R1199:Svil UTSW 18 5059217 splice site probably benign
R1472:Svil UTSW 18 5048950 missense probably benign 0.09
R1480:Svil UTSW 18 5057345 missense probably damaging 1.00
R1544:Svil UTSW 18 5046817 missense possibly damaging 0.93
R1626:Svil UTSW 18 5117099 critical splice donor site probably null
R1691:Svil UTSW 18 5056336 missense probably benign 0.06
R1812:Svil UTSW 18 5097545 missense probably damaging 1.00
R1826:Svil UTSW 18 5063383 missense probably benign 0.01
R1842:Svil UTSW 18 5062373 missense probably damaging 1.00
R1884:Svil UTSW 18 5094640 missense possibly damaging 0.94
R1945:Svil UTSW 18 5117059 missense probably damaging 1.00
R2184:Svil UTSW 18 5099534 missense probably damaging 1.00
R2184:Svil UTSW 18 5099615 missense probably damaging 1.00
R2232:Svil UTSW 18 5046640 start codon destroyed probably null 0.98
R2398:Svil UTSW 18 5060613 splice site probably null
R3076:Svil UTSW 18 5116055 missense probably damaging 1.00
R3777:Svil UTSW 18 5090855 missense probably damaging 0.97
R3779:Svil UTSW 18 5090855 missense probably damaging 0.97
R3797:Svil UTSW 18 5060534 missense probably benign 0.29
R4077:Svil UTSW 18 5063522 missense probably benign 0.03
R4350:Svil UTSW 18 5118154 missense probably damaging 1.00
R4379:Svil UTSW 18 5046909 missense probably damaging 1.00
R4488:Svil UTSW 18 5049067 missense probably damaging 1.00
R4777:Svil UTSW 18 5088813 missense probably damaging 0.99
R4825:Svil UTSW 18 5114564 missense probably damaging 1.00
R4921:Svil UTSW 18 5108631 missense probably damaging 1.00
R4969:Svil UTSW 18 5095516 missense probably damaging 1.00
R4975:Svil UTSW 18 5054025 missense possibly damaging 0.61
R4990:Svil UTSW 18 5056810 missense probably benign 0.05
R4991:Svil UTSW 18 5056810 missense probably benign 0.05
R5061:Svil UTSW 18 5048954 missense probably benign 0.02
R5271:Svil UTSW 18 5062329 missense probably benign 0.45
R5362:Svil UTSW 18 5057345 missense probably damaging 1.00
R5433:Svil UTSW 18 5059294 missense probably damaging 0.99
R5850:Svil UTSW 18 5098900 splice site probably null
R5868:Svil UTSW 18 5056854 splice site probably null
R5871:Svil UTSW 18 5103669 unclassified probably null
R5876:Svil UTSW 18 5082828 missense probably damaging 1.00
R6061:Svil UTSW 18 5106724 missense probably damaging 1.00
R6062:Svil UTSW 18 5106724 missense probably damaging 1.00
R6063:Svil UTSW 18 5106724 missense probably damaging 1.00
R6065:Svil UTSW 18 5106724 missense probably damaging 1.00
R6066:Svil UTSW 18 5106724 missense probably damaging 1.00
R6114:Svil UTSW 18 5108639 missense probably damaging 1.00
R6115:Svil UTSW 18 5108675 missense probably damaging 0.99
R6117:Svil UTSW 18 5116016 missense probably damaging 1.00
R6302:Svil UTSW 18 5057432 missense probably benign 0.13
R6418:Svil UTSW 18 5040171 missense probably benign 0.26
R6441:Svil UTSW 18 5049323 missense probably benign
R6446:Svil UTSW 18 5057323 missense probably benign 0.09
R6455:Svil UTSW 18 5056629 missense possibly damaging 0.89
R6545:Svil UTSW 18 5108621 missense probably benign 0.00
R6692:Svil UTSW 18 5082853 missense probably damaging 1.00
R6730:Svil UTSW 18 5049311 missense probably benign 0.17
R6763:Svil UTSW 18 5056437 missense probably damaging 0.99
R6870:Svil UTSW 18 5063231 missense possibly damaging 0.86
R6916:Svil UTSW 18 5114682 utr 3 prime probably benign
R7134:Svil UTSW 18 5116080 missense probably damaging 1.00
R7190:Svil UTSW 18 5092937 missense probably benign 0.01
R7213:Svil UTSW 18 5094574 missense probably damaging 0.99
R7249:Svil UTSW 18 5056270 missense probably benign 0.01
R7249:Svil UTSW 18 5062247 missense probably damaging 0.99
R7421:Svil UTSW 18 5056109 missense probably benign 0.18
R7571:Svil UTSW 18 5114636 missense probably damaging 1.00
R7574:Svil UTSW 18 5095188 missense probably benign 0.16
R7645:Svil UTSW 18 5099663 missense probably damaging 1.00
X0065:Svil UTSW 18 5062317 missense probably damaging 1.00
Z1177:Svil UTSW 18 5062344 missense not run
Predicted Primers PCR Primer
(F):5'- AGTATTTTGTGGTGCGCCCC -3'
(R):5'- CATCGATGTGACTGGATTTAGAGTC -3'

Sequencing Primer
(F):5'- CCTGGTGGGTGGAGACATTTATC -3'
(R):5'- GAGTCATTTCCAGAGAGGCTTCAC -3'
Posted On2016-11-09