Incidental Mutation 'R5677:Piezo2'
ID 442861
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Name piezo-type mechanosensitive ion channel component 2
Synonyms Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik
MMRRC Submission 043316-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5677 (G1)
Quality Score 210
Status Not validated
Chromosome 18
Chromosomal Location 63010213-63387183 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 63117696 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 212 (L212Q)
Ref Sequence ENSEMBL: ENSMUSP00000138170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046860] [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046860
AA Change: L444Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000036099
Gene: ENSMUSG00000041482
AA Change: L444Q

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000047480
AA Change: L444Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: L444Q

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000182166
AA Change: L336Q
Predicted Effect possibly damaging
Transcript: ENSMUST00000182233
AA Change: L212Q

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482
AA Change: L212Q

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 223 250 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 307 329 N/A INTRINSIC
SCOP:d1eq1a_ 365 434 1e-3 SMART
transmembrane domain 450 472 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
low complexity region 668 689 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 744 761 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
transmembrane domain 924 941 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183217
AA Change: L444Q

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: L444Q

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 886 907 N/A INTRINSIC
transmembrane domain 935 957 N/A INTRINSIC
transmembrane domain 962 979 N/A INTRINSIC
transmembrane domain 986 1008 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
transmembrane domain 1142 1159 N/A INTRINSIC
transmembrane domain 1172 1194 N/A INTRINSIC
transmembrane domain 1220 1242 N/A INTRINSIC
transmembrane domain 1294 1313 N/A INTRINSIC
transmembrane domain 1317 1339 N/A INTRINSIC
transmembrane domain 1352 1374 N/A INTRINSIC
coiled coil region 1460 1501 N/A INTRINSIC
low complexity region 1528 1537 N/A INTRINSIC
low complexity region 1558 1575 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik C T 10: 28,986,229 (GRCm38) V22I probably benign Het
4930430A15Rik T C 2: 111,211,565 (GRCm38) T342A probably benign Het
4931423N10Rik T A 2: 23,212,718 (GRCm38) L156Q probably damaging Het
Abca8a A T 11: 110,038,399 (GRCm38) V1296D possibly damaging Het
Abca8b C T 11: 109,940,861 (GRCm38) S1328N probably damaging Het
Adcy1 G A 11: 7,161,914 (GRCm38) M926I probably damaging Het
Aff4 G T 11: 53,400,275 (GRCm38) M687I possibly damaging Het
Agbl2 T A 2: 90,807,978 (GRCm38) Y636N possibly damaging Het
Agtr1a A T 13: 30,381,584 (GRCm38) I211F probably damaging Het
Alkbh8 T G 9: 3,385,147 (GRCm38) S480A possibly damaging Het
Ankrd13b A T 11: 77,477,544 (GRCm38) V84E probably damaging Het
Ap3b1 C T 13: 94,528,196 (GRCm38) T881I unknown Het
Apbb1 A C 7: 105,559,246 (GRCm38) D617E probably damaging Het
Apobec4 A G 1: 152,757,282 (GRCm38) R354G probably benign Het
BC003331 G A 1: 150,374,837 (GRCm38) L319F probably damaging Het
Brdt T G 5: 107,348,617 (GRCm38) C198W possibly damaging Het
Cacna1b G T 2: 24,679,358 (GRCm38) H851Q possibly damaging Het
Car2 G T 3: 14,898,055 (GRCm38) V217F possibly damaging Het
Ccdc24 A C 4: 117,869,880 (GRCm38) probably benign Het
Chodl C A 16: 78,941,315 (GRCm38) A57E probably damaging Het
Clgn G T 8: 83,409,538 (GRCm38) C185F probably damaging Het
Cltc G T 11: 86,705,242 (GRCm38) N1223K probably damaging Het
Cnot10 T C 9: 114,629,093 (GRCm38) N115S probably damaging Het
Col12a1 T C 9: 79,699,321 (GRCm38) R607G probably damaging Het
Cpd A G 11: 76,799,825 (GRCm38) V835A probably benign Het
Csmd3 G C 15: 48,622,051 (GRCm38) L153V probably damaging Het
Ctr9 A G 7: 111,044,002 (GRCm38) H527R probably benign Het
Cwc22 G A 2: 77,929,443 (GRCm38) R87W probably damaging Het
D930020B18Rik T A 10: 121,669,201 (GRCm38) N107K probably benign Het
Dgkg C A 16: 22,570,171 (GRCm38) V418L probably benign Het
Dhx40 A G 11: 86,800,963 (GRCm38) probably null Het
Diaph1 A T 18: 37,855,951 (GRCm38) M910K probably damaging Het
Diras2 T A 13: 52,507,675 (GRCm38) M199L possibly damaging Het
Dnah8 G A 17: 30,748,568 (GRCm38) D2585N probably benign Het
Dock5 T A 14: 67,777,603 (GRCm38) Q1302H probably benign Het
Dync1i2 T C 2: 71,228,623 (GRCm38) S90P probably benign Het
E2f8 A T 7: 48,867,195 (GRCm38) V812E probably damaging Het
Egfem1 C A 3: 29,690,174 (GRCm38) Q521K probably damaging Het
Fbxl18 A T 5: 142,878,720 (GRCm38) C699* probably null Het
Fgf3 C T 7: 144,838,783 (GRCm38) R26* probably null Het
Fpr-rs7 T G 17: 20,114,103 (GRCm38) I42L probably benign Het
Gm13101 A T 4: 143,965,138 (GRCm38) D338E possibly damaging Het
Gm3159 T A 14: 4,398,582 (GRCm38) M91K probably damaging Het
Gprin3 A G 6: 59,353,892 (GRCm38) S477P possibly damaging Het
Grm8 A T 6: 27,761,204 (GRCm38) probably null Het
Hepacam2 A T 6: 3,466,142 (GRCm38) D420E probably damaging Het
Hmcn1 A T 1: 150,609,778 (GRCm38) W4358R probably benign Het
Ifna6 G A 4: 88,827,719 (GRCm38) A102T probably benign Het
Ighv2-2 T C 12: 113,588,522 (GRCm38) Q32R probably benign Het
Igkv1-131 T A 6: 67,766,258 (GRCm38) Q47L possibly damaging Het
Il16 T C 7: 83,674,553 (GRCm38) E263G probably damaging Het
Kansl1 A T 11: 104,335,148 (GRCm38) C981S probably benign Het
Lrp1 A T 10: 127,574,429 (GRCm38) F1483I probably damaging Het
Ltf T C 9: 111,020,912 (GRCm38) M1T probably null Het
Ly75 C T 2: 60,299,082 (GRCm38) R1653H probably benign Het
Macrod2 T C 2: 142,176,667 (GRCm38) F240S probably damaging Het
Man1c1 T C 4: 134,569,060 (GRCm38) E433G probably damaging Het
Mansc4 A T 6: 147,081,549 (GRCm38) M130K probably benign Het
Mccc1 C T 3: 35,990,048 (GRCm38) probably null Het
Mink1 G T 11: 70,605,165 (GRCm38) R75L possibly damaging Het
Mst1 A G 9: 108,081,286 (GRCm38) D65G probably damaging Het
Myo9b C T 8: 71,343,686 (GRCm38) A857V probably damaging Het
Ndufa4 A G 6: 11,900,575 (GRCm38) V70A probably benign Het
Npat T A 9: 53,555,100 (GRCm38) S230T probably benign Het
Nr1d1 A G 11: 98,771,308 (GRCm38) Y167H probably damaging Het
Oca2 A G 7: 56,414,462 (GRCm38) D735G probably damaging Het
Olfr13 T C 6: 43,174,331 (GRCm38) V115A probably benign Het
Olfr1359 C T 13: 21,703,223 (GRCm38) T74I probably benign Het
Olfr1383 A G 11: 49,523,944 (GRCm38) T74A probably damaging Het
Olfr835 T A 9: 19,035,558 (GRCm38) I145N possibly damaging Het
Otop1 A G 5: 38,300,163 (GRCm38) Y422C probably damaging Het
Pde4dip G A 3: 97,841,648 (GRCm38) R126* probably null Het
Pdp2 C T 8: 104,594,688 (GRCm38) P390S probably damaging Het
Pds5b A T 5: 150,716,461 (GRCm38) T14S possibly damaging Het
Pfkp T C 13: 6,588,595 (GRCm38) E580G probably damaging Het
Pla2g4d T A 2: 120,278,948 (GRCm38) T207S possibly damaging Het
Plk2 C A 13: 110,399,057 (GRCm38) T471K possibly damaging Het
Ppp1r3g G A 13: 35,969,262 (GRCm38) E222K probably damaging Het
Prkcg A G 7: 3,323,458 (GRCm38) D480G probably damaging Het
Pxdc1 T A 13: 34,652,195 (GRCm38) T81S probably benign Het
Rnf150 A T 8: 83,003,599 (GRCm38) K253* probably null Het
Rsg1 C T 4: 141,219,866 (GRCm38) P186L probably benign Het
Sae1 T C 7: 16,370,462 (GRCm38) probably null Het
Scin C T 12: 40,063,259 (GRCm38) D538N probably damaging Het
Serpinb3c C A 1: 107,271,803 (GRCm38) K329N probably damaging Het
Sgo2b T A 8: 63,926,974 (GRCm38) K941N possibly damaging Het
Six1 C T 12: 73,046,284 (GRCm38) S48N possibly damaging Het
Slc39a8 G A 3: 135,884,688 (GRCm38) G381R probably damaging Het
Slc9b1 A G 3: 135,357,559 (GRCm38) K35E unknown Het
Srek1 C T 13: 103,759,244 (GRCm38) A274T probably damaging Het
Steap2 A T 5: 5,677,497 (GRCm38) Y279* probably null Het
Svil T A 18: 5,046,823 (GRCm38) L110* probably null Het
Syncrip T C 9: 88,456,709 (GRCm38) probably benign Het
Tcf20 A G 15: 82,853,242 (GRCm38) I1336T probably benign Het
Tecpr1 T A 5: 144,218,633 (GRCm38) K36* probably null Het
Tenm2 A G 11: 36,141,683 (GRCm38) V670A probably damaging Het
Thbd G A 2: 148,407,366 (GRCm38) T194I probably damaging Het
Tm9sf2 A T 14: 122,151,962 (GRCm38) probably null Het
Tmtc4 A T 14: 122,950,499 (GRCm38) I225N probably damaging Het
Tpp1 C T 7: 105,747,536 (GRCm38) V425M probably damaging Het
Trbc2 T A 6: 41,547,812 (GRCm38) Y144* probably null Het
Trps1 T C 15: 50,846,108 (GRCm38) D282G probably damaging Het
Tsc22d4 T A 5: 137,747,142 (GRCm38) S9R probably damaging Het
Upp1 T A 11: 9,136,025 (GRCm38) D287E probably benign Het
Uso1 A C 5: 92,201,299 (GRCm38) Q916H probably damaging Het
Uty T A Y: 1,134,902 (GRCm38) Y884F probably damaging Het
Vmn1r222 T C 13: 23,232,780 (GRCm38) R88G probably damaging Het
Vmn1r79 T C 7: 12,177,001 (GRCm38) V270A possibly damaging Het
Zbtb22 T C 17: 33,917,735 (GRCm38) S285P probably benign Het
Zfp385a A G 15: 103,318,065 (GRCm38) V82A probably damaging Het
Zfp59 T C 7: 27,854,169 (GRCm38) F349L probably benign Het
Zfp780b T G 7: 27,962,799 (GRCm38) H777P probably benign Het
Zfp82 T C 7: 30,057,124 (GRCm38) T178A probably benign Het
Zfp850 T C 7: 27,989,088 (GRCm38) Y565C probably damaging Het
Zfp957 A G 14: 79,212,767 (GRCm38) Y531H probably damaging Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63,117,699 (GRCm38) missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63,022,460 (GRCm38) missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63,070,030 (GRCm38) missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63,124,614 (GRCm38) missense probably benign 0.03
IGL01568:Piezo2 APN 18 63,030,392 (GRCm38) missense probably benign 0.28
IGL01653:Piezo2 APN 18 63,182,833 (GRCm38) splice site probably benign
IGL01674:Piezo2 APN 18 63,027,559 (GRCm38) missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63,083,170 (GRCm38) missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63,042,788 (GRCm38) missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63,092,844 (GRCm38) missense probably benign 0.10
IGL02183:Piezo2 APN 18 63,020,634 (GRCm38) missense probably benign 0.00
IGL02407:Piezo2 APN 18 63,146,844 (GRCm38) missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63,072,862 (GRCm38) missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63,032,924 (GRCm38) missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63,024,475 (GRCm38) missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63,074,659 (GRCm38) missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63,020,633 (GRCm38) missense probably benign 0.18
IGL02851:Piezo2 APN 18 63,020,633 (GRCm38) missense probably benign 0.18
IGL02972:Piezo2 APN 18 63,064,785 (GRCm38) splice site probably benign
IGL03011:Piezo2 APN 18 63,124,660 (GRCm38) missense probably benign 0.03
IGL03078:Piezo2 APN 18 63,070,075 (GRCm38) missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63,030,272 (GRCm38) splice site probably null
IGL03129:Piezo2 APN 18 63,114,972 (GRCm38) missense probably benign
IGL03143:Piezo2 APN 18 63,108,076 (GRCm38) missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63,011,598 (GRCm38) missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63,124,606 (GRCm38) missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63,053,062 (GRCm38) missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63,041,720 (GRCm38) missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63,011,538 (GRCm38) utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63,021,308 (GRCm38) missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63,027,704 (GRCm38) missense probably damaging 1.00
Piccolo UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
sopranino UTSW 18 63,024,466 (GRCm38) missense probably damaging 1.00
woodwind UTSW 18 63,124,642 (GRCm38) missense possibly damaging 0.50
P0023:Piezo2 UTSW 18 63,386,200 (GRCm38) splice site probably benign
PIT4802001:Piezo2 UTSW 18 63,024,469 (GRCm38) missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63,102,084 (GRCm38) missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63,024,491 (GRCm38) missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63,029,061 (GRCm38) missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63,102,174 (GRCm38) missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63,024,451 (GRCm38) missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63,027,544 (GRCm38) missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63,022,481 (GRCm38) missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63,022,426 (GRCm38) missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63,019,258 (GRCm38) missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63,041,723 (GRCm38) missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63,083,235 (GRCm38) missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63,015,802 (GRCm38) missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63,086,753 (GRCm38) missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63,021,254 (GRCm38) missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63,083,131 (GRCm38) missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63,144,919 (GRCm38) missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63,082,915 (GRCm38) missense probably benign 0.03
R1649:Piezo2 UTSW 18 63,117,672 (GRCm38) missense probably benign 0.34
R1741:Piezo2 UTSW 18 63,021,173 (GRCm38) missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63,124,642 (GRCm38) missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63,106,284 (GRCm38) missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63,108,087 (GRCm38) missense probably damaging 1.00
R1799:Piezo2 UTSW 18 63,032,840 (GRCm38) critical splice donor site probably null
R1868:Piezo2 UTSW 18 63,019,344 (GRCm38) missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63,113,960 (GRCm38) missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63,078,840 (GRCm38) missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63,074,662 (GRCm38) missense probably null 1.00
R1991:Piezo2 UTSW 18 63,074,662 (GRCm38) missense probably null 1.00
R1992:Piezo2 UTSW 18 63,074,662 (GRCm38) missense probably null 1.00
R1995:Piezo2 UTSW 18 63,078,781 (GRCm38) missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63,144,926 (GRCm38) missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63,059,744 (GRCm38) missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63,118,935 (GRCm38) missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63,081,734 (GRCm38) missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63,117,720 (GRCm38) missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63,114,041 (GRCm38) missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63,081,662 (GRCm38) critical splice donor site probably null
R2183:Piezo2 UTSW 18 63,106,274 (GRCm38) missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63,145,072 (GRCm38) missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63,145,072 (GRCm38) missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63,022,525 (GRCm38) missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63,245,624 (GRCm38) missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63,053,035 (GRCm38) missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63,146,843 (GRCm38) missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63,024,435 (GRCm38) nonsense probably null
R3016:Piezo2 UTSW 18 63,042,832 (GRCm38) missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63,081,793 (GRCm38) missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63,081,662 (GRCm38) critical splice donor site probably null
R3833:Piezo2 UTSW 18 63,081,662 (GRCm38) critical splice donor site probably null
R3968:Piezo2 UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63,050,604 (GRCm38) missense probably benign
R4181:Piezo2 UTSW 18 63,124,730 (GRCm38) critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63,084,840 (GRCm38) missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63,124,730 (GRCm38) critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63,102,099 (GRCm38) missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63,114,063 (GRCm38) missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63,072,880 (GRCm38) missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63,086,628 (GRCm38) missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63,069,963 (GRCm38) missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63,030,401 (GRCm38) missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63,030,401 (GRCm38) missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63,144,954 (GRCm38) missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63,078,791 (GRCm38) missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63,157,262 (GRCm38) missense probably benign
R4961:Piezo2 UTSW 18 63,052,961 (GRCm38) splice site probably null
R4968:Piezo2 UTSW 18 63,144,971 (GRCm38) nonsense probably null
R4973:Piezo2 UTSW 18 63,074,680 (GRCm38) missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63,083,113 (GRCm38) missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63,024,536 (GRCm38) missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63,074,620 (GRCm38) missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63,030,409 (GRCm38) missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63,032,929 (GRCm38) missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63,064,731 (GRCm38) missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63,084,740 (GRCm38) missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63,145,105 (GRCm38) missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63,027,864 (GRCm38) missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63,011,721 (GRCm38) missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63,145,091 (GRCm38) missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63,117,697 (GRCm38) missense probably benign 0.25
R5792:Piezo2 UTSW 18 63,146,856 (GRCm38) missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63,027,901 (GRCm38) missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63,113,934 (GRCm38) missense probably benign 0.22
R6036:Piezo2 UTSW 18 63,114,948 (GRCm38) nonsense probably null
R6036:Piezo2 UTSW 18 63,114,948 (GRCm38) nonsense probably null
R6073:Piezo2 UTSW 18 63,012,645 (GRCm38) missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63,157,210 (GRCm38) nonsense probably null
R6255:Piezo2 UTSW 18 63,121,270 (GRCm38) missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63,117,678 (GRCm38) missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63,106,293 (GRCm38) missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63,086,607 (GRCm38) missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63,041,663 (GRCm38) missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63,106,271 (GRCm38) missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63,021,328 (GRCm38) missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63,021,262 (GRCm38) missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63,032,889 (GRCm38) nonsense probably null
R6855:Piezo2 UTSW 18 63,090,879 (GRCm38) critical splice donor site probably null
R6927:Piezo2 UTSW 18 63,032,986 (GRCm38) missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63,082,961 (GRCm38) critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63,145,110 (GRCm38) nonsense probably null
R7162:Piezo2 UTSW 18 63,124,709 (GRCm38) missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63,108,030 (GRCm38) missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63,017,519 (GRCm38) splice site probably null
R7395:Piezo2 UTSW 18 63,027,563 (GRCm38) missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63,024,472 (GRCm38) missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63,012,723 (GRCm38) missense probably benign
R7517:Piezo2 UTSW 18 63,082,925 (GRCm38) missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63,053,010 (GRCm38) missense probably benign 0.01
R7612:Piezo2 UTSW 18 63,042,539 (GRCm38) missense probably benign 0.12
R7829:Piezo2 UTSW 18 63,113,876 (GRCm38) critical splice donor site probably null
R7835:Piezo2 UTSW 18 63,082,945 (GRCm38) missense probably benign 0.12
R8014:Piezo2 UTSW 18 63,083,200 (GRCm38) missense probably benign 0.02
R8055:Piezo2 UTSW 18 63,042,811 (GRCm38) missense probably damaging 0.99
R8062:Piezo2 UTSW 18 63,030,466 (GRCm38) missense possibly damaging 0.87
R8306:Piezo2 UTSW 18 63,075,730 (GRCm38) missense probably damaging 1.00
R8332:Piezo2 UTSW 18 63,012,786 (GRCm38) missense possibly damaging 0.67
R8355:Piezo2 UTSW 18 63,090,998 (GRCm38) missense probably damaging 1.00
R8383:Piezo2 UTSW 18 63,084,688 (GRCm38) missense probably damaging 0.97
R8455:Piezo2 UTSW 18 63,090,998 (GRCm38) missense probably damaging 1.00
R8501:Piezo2 UTSW 18 63,045,540 (GRCm38) missense probably damaging 0.99
R8523:Piezo2 UTSW 18 63,146,802 (GRCm38) missense probably damaging 0.99
R8692:Piezo2 UTSW 18 63,092,900 (GRCm38) nonsense probably null
R8708:Piezo2 UTSW 18 63,093,015 (GRCm38) missense probably damaging 1.00
R8726:Piezo2 UTSW 18 63,109,885 (GRCm38) missense probably benign
R8727:Piezo2 UTSW 18 63,109,885 (GRCm38) missense probably benign
R8810:Piezo2 UTSW 18 63,114,963 (GRCm38) missense probably benign 0.41
R8900:Piezo2 UTSW 18 63,115,025 (GRCm38) missense probably benign 0.04
R9037:Piezo2 UTSW 18 63,092,831 (GRCm38) missense probably benign 0.31
R9079:Piezo2 UTSW 18 63,024,466 (GRCm38) missense probably damaging 1.00
R9090:Piezo2 UTSW 18 63,075,719 (GRCm38) missense probably damaging 0.99
R9090:Piezo2 UTSW 18 63,030,379 (GRCm38) missense probably damaging 0.99
R9123:Piezo2 UTSW 18 63,045,518 (GRCm38) missense probably benign 0.00
R9125:Piezo2 UTSW 18 63,045,518 (GRCm38) missense probably benign 0.00
R9171:Piezo2 UTSW 18 63,045,479 (GRCm38) missense probably benign 0.04
R9194:Piezo2 UTSW 18 63,117,744 (GRCm38) missense probably benign 0.03
R9203:Piezo2 UTSW 18 63,157,231 (GRCm38) missense probably benign 0.00
R9209:Piezo2 UTSW 18 63,021,301 (GRCm38) missense probably damaging 1.00
R9261:Piezo2 UTSW 18 63,075,797 (GRCm38) missense possibly damaging 0.84
R9271:Piezo2 UTSW 18 63,030,379 (GRCm38) missense probably damaging 0.99
R9271:Piezo2 UTSW 18 63,075,719 (GRCm38) missense probably damaging 0.99
R9283:Piezo2 UTSW 18 63,024,566 (GRCm38) missense probably damaging 1.00
R9377:Piezo2 UTSW 18 63,029,085 (GRCm38) missense possibly damaging 0.48
R9499:Piezo2 UTSW 18 63,032,962 (GRCm38) missense possibly damaging 0.67
R9531:Piezo2 UTSW 18 63,102,165 (GRCm38) missense possibly damaging 0.95
R9551:Piezo2 UTSW 18 63,032,962 (GRCm38) missense possibly damaging 0.67
R9607:Piezo2 UTSW 18 63,386,276 (GRCm38) start gained probably benign
R9608:Piezo2 UTSW 18 63,146,945 (GRCm38) missense probably benign 0.09
R9617:Piezo2 UTSW 18 63,115,037 (GRCm38) missense probably benign 0.43
R9624:Piezo2 UTSW 18 63,064,696 (GRCm38) missense possibly damaging 0.88
X0017:Piezo2 UTSW 18 63,027,586 (GRCm38) missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63,050,610 (GRCm38) missense probably benign 0.43
X0060:Piezo2 UTSW 18 63,017,577 (GRCm38) missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63,069,994 (GRCm38) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCTCACTTCACTGTAGGGC -3'
(R):5'- AATGGTTCAGCCTCTAATCAGC -3'

Sequencing Primer
(F):5'- GACGTCAGTATTCTGCTAGCAGC -3'
(R):5'- AATCAGCTTTTTATCCTGCATGATGC -3'
Posted On 2016-11-09