Incidental Mutation 'R5678:Clcn1'
ID 442883
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Name chloride channel, voltage-sensitive 1
Synonyms Clc1, SMCC1, NMF355, Clc-1, nmf355
MMRRC Submission 043317-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5678 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 42263619-42292690 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42284199 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 589 (Y589C)
Ref Sequence ENSEMBL: ENSMUSP00000031894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]
AlphaFold Q64347
Predicted Effect probably damaging
Transcript: ENSMUST00000031894
AA Change: Y589C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: Y589C

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114684
SMART Domains Protein: ENSMUSP00000110332
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
Pfam:Voltage_CLC 3 254 2.6e-42 PFAM
CBS 294 344 1.3e1 SMART
low complexity region 405 429 N/A INTRINSIC
Blast:CBS 480 524 2e-13 BLAST
low complexity region 575 597 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163235
SMART Domains Protein: ENSMUSP00000132387
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163936
AA Change: Y517C
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: Y517C

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164091
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165780
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168660
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169024
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170028
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Meta Mutation Damage Score 0.8559 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,466,529 (GRCm39) T168A probably damaging Het
3425401B19Rik T A 14: 32,384,010 (GRCm39) R652W probably damaging Het
A530016L24Rik T G 12: 112,463,306 (GRCm39) C43W probably damaging Het
Aatk T C 11: 119,900,980 (GRCm39) T1082A probably benign Het
Acsl1 T A 8: 46,945,887 (GRCm39) F7I probably benign Het
Adgb T G 10: 10,307,070 (GRCm39) S299R possibly damaging Het
Apob T C 12: 8,041,494 (GRCm39) F738L possibly damaging Het
Art3 T C 5: 92,540,409 (GRCm39) Y51H probably damaging Het
Atr C T 9: 95,833,540 (GRCm39) Q2597* probably null Het
Atrn T C 2: 130,811,936 (GRCm39) V627A probably damaging Het
Baz1a T C 12: 54,947,317 (GRCm39) K1111E probably damaging Het
Ccdc40 T C 11: 119,122,398 (GRCm39) S67P possibly damaging Het
Cd164 T C 10: 41,395,948 (GRCm39) probably null Het
Cep295 T C 9: 15,234,154 (GRCm39) D2214G probably damaging Het
Col1a2 C T 6: 4,536,239 (GRCm39) A998V unknown Het
Csrnp2 T C 15: 100,379,685 (GRCm39) *535W probably null Het
Dhrs7 C T 12: 72,704,106 (GRCm39) G130D probably damaging Het
Dnah3 T C 7: 119,677,074 (GRCm39) T477A probably benign Het
Dscam A G 16: 96,592,100 (GRCm39) F725S probably benign Het
Dstyk T C 1: 132,381,029 (GRCm39) V508A probably benign Het
Eif4g3 A G 4: 137,879,053 (GRCm39) E595G probably damaging Het
Epha6 A T 16: 59,639,342 (GRCm39) V844E probably damaging Het
Esrp2 G A 8: 106,858,750 (GRCm39) A629V probably damaging Het
Fndc3b A G 3: 27,483,172 (GRCm39) S1009P probably benign Het
Gm8257 A T 14: 44,894,706 (GRCm39) I28N probably damaging Het
Ighv5-9-1 T C 12: 113,700,207 (GRCm39) E4G possibly damaging Het
Ints3 A G 3: 90,310,855 (GRCm39) V455A probably damaging Het
Lamtor2 A G 3: 88,458,101 (GRCm39) probably benign Het
Npy1r T C 8: 67,156,855 (GRCm39) C92R probably damaging Het
Nup210l T C 3: 90,098,266 (GRCm39) V1406A probably damaging Het
Or10g7 T C 9: 39,905,199 (GRCm39) V31A probably benign Het
Or4a75 A G 2: 89,447,625 (GRCm39) F304L probably benign Het
Or4c108 A T 2: 88,803,317 (GRCm39) L306* probably null Het
Prune2 A G 19: 17,096,032 (GRCm39) D512G probably damaging Het
Qdpr T C 5: 45,604,979 (GRCm39) E43G possibly damaging Het
Rps6ka5 T C 12: 100,691,135 (GRCm39) E2G unknown Het
Setd2 A G 9: 110,431,254 (GRCm39) T5A probably damaging Het
Slc66a2 T C 18: 80,300,249 (GRCm39) I40T probably damaging Het
Srpk2 TCA T 5: 23,729,604 (GRCm39) probably null Het
Sympk T C 7: 18,783,397 (GRCm39) probably null Het
Tasor CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,151,080 (GRCm39) probably benign Het
Tchh A T 3: 93,352,933 (GRCm39) Q791L unknown Het
Tmed11 T C 5: 108,934,031 (GRCm39) D55G probably benign Het
Tnrc18 T C 5: 142,719,319 (GRCm39) D1989G unknown Het
Utp20 A T 10: 88,644,979 (GRCm39) H582Q probably benign Het
Utrn A G 10: 12,317,762 (GRCm39) I554T probably damaging Het
Zfp1005 A T 2: 150,110,425 (GRCm39) R372* probably null Het
Zfp119a T C 17: 56,175,336 (GRCm39) E53G probably benign Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42,268,637 (GRCm39) missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42,287,606 (GRCm39) splice site probably benign
IGL02055:Clcn1 APN 6 42,284,489 (GRCm39) missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42,284,007 (GRCm39) splice site probably benign
IGL02649:Clcn1 APN 6 42,275,763 (GRCm39) missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42,263,714 (GRCm39) splice site probably null
IGL03148:Clcn1 APN 6 42,276,925 (GRCm39) critical splice donor site probably null
IGL03190:Clcn1 APN 6 42,267,037 (GRCm39) missense probably benign 0.02
IGL03327:Clcn1 APN 6 42,288,153 (GRCm39) missense probably benign 0.00
IGL03346:Clcn1 APN 6 42,288,153 (GRCm39) missense probably benign 0.00
Faint UTSW 6 42,284,199 (GRCm39) missense probably damaging 1.00
jack_spratt UTSW 6 42,287,515 (GRCm39) missense probably benign
Limitations UTSW 6 42,286,997 (GRCm39) missense possibly damaging 0.79
maimed UTSW 6 42,275,754 (GRCm39) missense probably damaging 1.00
stunted UTSW 6 42,263,701 (GRCm39) start codon destroyed possibly damaging 0.79
R0167:Clcn1 UTSW 6 42,263,770 (GRCm39) missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42,287,074 (GRCm39) missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42,287,515 (GRCm39) missense probably benign
R0573:Clcn1 UTSW 6 42,289,979 (GRCm39) splice site probably null
R0615:Clcn1 UTSW 6 42,282,509 (GRCm39) missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42,290,075 (GRCm39) missense probably benign 0.00
R1562:Clcn1 UTSW 6 42,277,169 (GRCm39) missense probably benign 0.29
R1566:Clcn1 UTSW 6 42,268,374 (GRCm39) missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42,290,032 (GRCm39) missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42,271,079 (GRCm39) missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42,275,860 (GRCm39) critical splice donor site probably null
R1861:Clcn1 UTSW 6 42,290,925 (GRCm39) missense possibly damaging 0.63
R1864:Clcn1 UTSW 6 42,282,475 (GRCm39) missense probably damaging 1.00
R1865:Clcn1 UTSW 6 42,282,475 (GRCm39) missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42,268,559 (GRCm39) missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42,290,046 (GRCm39) missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42,275,784 (GRCm39) missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42,267,112 (GRCm39) missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42,269,929 (GRCm39) missense probably damaging 0.99
R3747:Clcn1 UTSW 6 42,276,849 (GRCm39) missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42,276,849 (GRCm39) missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42,286,902 (GRCm39) missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42,267,131 (GRCm39) splice site probably null
R4836:Clcn1 UTSW 6 42,286,898 (GRCm39) missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42,287,922 (GRCm39) nonsense probably null
R5085:Clcn1 UTSW 6 42,290,814 (GRCm39) missense probably benign 0.41
R5528:Clcn1 UTSW 6 42,277,275 (GRCm39) missense probably benign 0.01
R5628:Clcn1 UTSW 6 42,275,823 (GRCm39) missense probably damaging 0.96
R5943:Clcn1 UTSW 6 42,269,900 (GRCm39) missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42,277,208 (GRCm39) nonsense probably null
R6175:Clcn1 UTSW 6 42,291,096 (GRCm39) missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42,290,172 (GRCm39) missense possibly damaging 0.82
R6394:Clcn1 UTSW 6 42,284,524 (GRCm39) missense possibly damaging 0.84
R7012:Clcn1 UTSW 6 42,267,542 (GRCm39) missense probably benign 0.01
R7020:Clcn1 UTSW 6 42,275,754 (GRCm39) missense probably damaging 1.00
R7048:Clcn1 UTSW 6 42,284,477 (GRCm39) missense probably damaging 1.00
R7212:Clcn1 UTSW 6 42,268,323 (GRCm39) missense possibly damaging 0.46
R7225:Clcn1 UTSW 6 42,270,396 (GRCm39) missense probably damaging 1.00
R7264:Clcn1 UTSW 6 42,275,772 (GRCm39) missense probably damaging 1.00
R7636:Clcn1 UTSW 6 42,268,268 (GRCm39) nonsense probably null
R7663:Clcn1 UTSW 6 42,286,997 (GRCm39) missense possibly damaging 0.79
R7807:Clcn1 UTSW 6 42,287,282 (GRCm39) splice site probably null
R7954:Clcn1 UTSW 6 42,263,625 (GRCm39) unclassified probably benign
R8026:Clcn1 UTSW 6 42,284,595 (GRCm39) critical splice donor site probably null
R8045:Clcn1 UTSW 6 42,267,628 (GRCm39) missense probably damaging 1.00
R8499:Clcn1 UTSW 6 42,284,133 (GRCm39) missense probably damaging 1.00
R8523:Clcn1 UTSW 6 42,284,523 (GRCm39) nonsense probably null
R8677:Clcn1 UTSW 6 42,267,519 (GRCm39) critical splice acceptor site probably null
R8818:Clcn1 UTSW 6 42,282,477 (GRCm39) missense probably damaging 0.98
R8945:Clcn1 UTSW 6 42,263,701 (GRCm39) start codon destroyed possibly damaging 0.79
R9012:Clcn1 UTSW 6 42,268,567 (GRCm39) missense possibly damaging 0.75
R9295:Clcn1 UTSW 6 42,290,883 (GRCm39) missense probably benign 0.00
R9433:Clcn1 UTSW 6 42,282,494 (GRCm39) missense probably damaging 1.00
R9513:Clcn1 UTSW 6 42,282,462 (GRCm39) missense probably damaging 1.00
R9679:Clcn1 UTSW 6 42,263,753 (GRCm39) missense probably damaging 0.98
Z1088:Clcn1 UTSW 6 42,284,190 (GRCm39) missense probably damaging 1.00
Z1088:Clcn1 UTSW 6 42,277,294 (GRCm39) missense probably benign 0.40
Z1176:Clcn1 UTSW 6 42,284,501 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCATTCCAGGAGCAGCAG -3'
(R):5'- GTTAGCCCACTCTTGGCCTATG -3'

Sequencing Primer
(F):5'- AGCAGCTTTGACAGGGGC -3'
(R):5'- TTCCCACAAAGTCTGCCATG -3'
Posted On 2016-11-09