Incidental Mutation 'R5678:Adgb'
ID442893
Institutional Source Beutler Lab
Gene Symbol Adgb
Ensembl Gene ENSMUSG00000050994
Gene Nameandroglobin
Synonyms9130014G24Rik
MMRRC Submission 043317-MU
Accession Numbers

MGI:3605549

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5678 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location10335703-10472326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 10431326 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 299 (S299R)
Ref Sequence ENSEMBL: ENSMUSP00000146658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045328] [ENSMUST00000132573] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]
Predicted Effect probably benign
Transcript: ENSMUST00000045328
SMART Domains Protein: ENSMUSP00000045452
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 11 257 1e-165 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132573
AA Change: S305R

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994
AA Change: S305R

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172530
AA Change: S305R

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: S305R

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
IQ 904 926 6.41e0 SMART
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1318 1335 N/A INTRINSIC
coiled coil region 1534 1559 N/A INTRINSIC
low complexity region 1616 1633 N/A INTRINSIC
low complexity region 1649 1657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179956
AA Change: S305R

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: S305R

DomainStartEndE-ValueType
CysPc 56 657 5.36e-2 SMART
IQ 906 928 6.41e0 SMART
low complexity region 1181 1192 N/A INTRINSIC
low complexity region 1321 1338 N/A INTRINSIC
coiled coil region 1537 1562 N/A INTRINSIC
low complexity region 1619 1636 N/A INTRINSIC
low complexity region 1652 1660 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208717
AA Change: S299R

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.2370 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,516,529 T168A probably damaging Het
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
A530016L24Rik T G 12: 112,496,872 C43W probably damaging Het
Aatk T C 11: 120,010,154 T1082A probably benign Het
Acsl1 T A 8: 46,492,850 F7I probably benign Het
Apob T C 12: 7,991,494 F738L possibly damaging Het
Art3 T C 5: 92,392,550 Y51H probably damaging Het
Atr C T 9: 95,951,487 Q2597* probably null Het
Atrn T C 2: 130,970,016 V627A probably damaging Het
Baz1a T C 12: 54,900,532 K1111E probably damaging Het
Ccdc40 T C 11: 119,231,572 S67P possibly damaging Het
Cd164 T C 10: 41,519,952 probably null Het
Cep295 T C 9: 15,322,858 D2214G probably damaging Het
Clcn1 A G 6: 42,307,265 Y589C probably damaging Het
Col1a2 C T 6: 4,536,239 A998V unknown Het
Csrnp2 T C 15: 100,481,804 *535W probably null Het
Dhrs7 C T 12: 72,657,332 G130D probably damaging Het
Dnah3 T C 7: 120,077,851 T477A probably benign Het
Dscam A G 16: 96,790,900 F725S probably benign Het
Dstyk T C 1: 132,453,291 V508A probably benign Het
Eif4g3 A G 4: 138,151,742 E595G probably damaging Het
Epha6 A T 16: 59,818,979 V844E probably damaging Het
Esrp2 G A 8: 106,132,118 A629V probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
Fndc3b A G 3: 27,429,023 S1009P probably benign Het
Gm13762 A T 2: 88,972,973 L306* probably null Het
Gm14124 A T 2: 150,268,505 R372* probably null Het
Gm8257 A T 14: 44,657,249 I28N probably damaging Het
Ighv5-9-1 T C 12: 113,736,587 E4G possibly damaging Het
Ints3 A G 3: 90,403,548 V455A probably damaging Het
Lamtor2 A G 3: 88,550,794 probably benign Het
Npy1r T C 8: 66,704,203 C92R probably damaging Het
Nup210l T C 3: 90,190,959 V1406A probably damaging Het
Olfr1248 A G 2: 89,617,281 F304L probably benign Het
Olfr978 T C 9: 39,993,903 V31A probably benign Het
Pqlc1 T C 18: 80,257,034 I40T probably damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Qdpr T C 5: 45,447,637 E43G possibly damaging Het
Rps6ka5 T C 12: 100,724,876 E2G unknown Het
Setd2 A G 9: 110,602,186 T5A probably damaging Het
Srpk2 TCA T 5: 23,524,606 probably null Het
Sympk T C 7: 19,049,472 probably null Het
Tchh A T 3: 93,445,626 Q791L unknown Het
Tmed11 T C 5: 108,786,165 D55G probably benign Het
Tnrc18 T C 5: 142,733,564 D1989G unknown Het
Utp20 A T 10: 88,809,117 H582Q probably benign Het
Utrn A G 10: 12,442,018 I554T probably damaging Het
Zfp119a T C 17: 55,868,336 E53G probably benign Het
Other mutations in Adgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Adgb APN 10 10406099 missense possibly damaging 0.87
IGL01083:Adgb APN 10 10407554 missense possibly damaging 0.50
IGL03064:Adgb APN 10 10400572 missense probably benign 0.02
R0080:Adgb UTSW 10 10377839 splice site probably benign
R0084:Adgb UTSW 10 10396344 missense possibly damaging 0.74
R0112:Adgb UTSW 10 10407158 splice site probably benign
R0348:Adgb UTSW 10 10357879 missense probably benign
R0415:Adgb UTSW 10 10431067 splice site probably null
R0633:Adgb UTSW 10 10391729 missense probably benign 0.36
R1052:Adgb UTSW 10 10442613 missense probably benign 0.29
R1248:Adgb UTSW 10 10395310 missense probably damaging 0.98
R1278:Adgb UTSW 10 10382828 missense probably damaging 1.00
R1568:Adgb UTSW 10 10442665 nonsense probably null
R1647:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1648:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1663:Adgb UTSW 10 10339675 missense possibly damaging 0.86
R1688:Adgb UTSW 10 10350317 nonsense probably null
R1758:Adgb UTSW 10 10426605 missense probably damaging 1.00
R1772:Adgb UTSW 10 10382721 splice site probably benign
R1850:Adgb UTSW 10 10442502 missense probably damaging 1.00
R1959:Adgb UTSW 10 10395249 missense probably benign 0.02
R1980:Adgb UTSW 10 10433498 missense probably benign
R2179:Adgb UTSW 10 10395274 missense possibly damaging 0.94
R2229:Adgb UTSW 10 10436051 missense probably damaging 1.00
R2283:Adgb UTSW 10 10377891 missense probably damaging 0.99
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2875:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2876:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2920:Adgb UTSW 10 10390243 missense probably damaging 1.00
R2931:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R3722:Adgb UTSW 10 10340510 missense probably benign 0.32
R3846:Adgb UTSW 10 10382721 splice site probably benign
R3877:Adgb UTSW 10 10442483 critical splice donor site probably null
R4210:Adgb UTSW 10 10407465 missense probably benign 0.06
R4211:Adgb UTSW 10 10407465 missense probably benign 0.06
R4333:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R4448:Adgb UTSW 10 10390825 missense probably benign 0.32
R4470:Adgb UTSW 10 10398951 missense probably benign 0.02
R4624:Adgb UTSW 10 10403004 missense probably benign 0.00
R4656:Adgb UTSW 10 10405306 missense probably damaging 0.99
R4676:Adgb UTSW 10 10426710 missense probably damaging 1.00
R4792:Adgb UTSW 10 10398903 missense probably damaging 0.96
R4795:Adgb UTSW 10 10357872 missense probably benign 0.01
R4858:Adgb UTSW 10 10349577 missense probably damaging 1.00
R4985:Adgb UTSW 10 10400632 missense possibly damaging 0.69
R5057:Adgb UTSW 10 10357978 missense probably benign 0.11
R5157:Adgb UTSW 10 10398966 missense probably damaging 1.00
R5209:Adgb UTSW 10 10398937 missense possibly damaging 0.71
R5339:Adgb UTSW 10 10442606 missense probably damaging 1.00
R5376:Adgb UTSW 10 10346563 missense probably benign 0.09
R5426:Adgb UTSW 10 10350260 missense probably benign 0.14
R5516:Adgb UTSW 10 10431157 missense probably damaging 1.00
R5554:Adgb UTSW 10 10340473 missense probably damaging 0.98
R5707:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5708:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5891:Adgb UTSW 10 10377847 nonsense probably null
R5928:Adgb UTSW 10 10378787 missense probably damaging 1.00
R6005:Adgb UTSW 10 10395352 missense probably damaging 1.00
R6017:Adgb UTSW 10 10450036 missense probably damaging 1.00
R6049:Adgb UTSW 10 10378026 missense probably damaging 1.00
R6118:Adgb UTSW 10 10431291 missense probably damaging 1.00
R6175:Adgb UTSW 10 10398943 missense possibly damaging 0.94
R6186:Adgb UTSW 10 10422758 missense probably damaging 1.00
R6234:Adgb UTSW 10 10353080 splice site probably null
R6383:Adgb UTSW 10 10450028 missense probably damaging 1.00
R6522:Adgb UTSW 10 10377892 nonsense probably null
R6639:Adgb UTSW 10 10435956 missense possibly damaging 0.51
R6697:Adgb UTSW 10 10406126 nonsense probably null
R6742:Adgb UTSW 10 10411849 missense probably damaging 1.00
R6745:Adgb UTSW 10 10390197 missense probably damaging 1.00
R6850:Adgb UTSW 10 10394574 missense probably benign 0.39
R7128:Adgb UTSW 10 10472241 missense probably benign 0.26
R7326:Adgb UTSW 10 10400574 missense possibly damaging 0.80
R7386:Adgb UTSW 10 10377949 missense possibly damaging 0.52
R7431:Adgb UTSW 10 10391955 splice site probably null
R7569:Adgb UTSW 10 10431252 missense probably benign
R7579:Adgb UTSW 10 10410818 nonsense probably null
R7582:Adgb UTSW 10 10390821 missense probably damaging 1.00
R7615:Adgb UTSW 10 10436010 missense probably damaging 0.96
R7692:Adgb UTSW 10 10411712 critical splice donor site probably null
R7774:Adgb UTSW 10 10339660 nonsense probably null
R7808:Adgb UTSW 10 10378659 splice site probably null
R8158:Adgb UTSW 10 10378734 missense probably benign 0.22
R8386:Adgb UTSW 10 10350304 missense probably damaging 1.00
X0003:Adgb UTSW 10 10394630 missense possibly damaging 0.76
Z1176:Adgb UTSW 10 10378742 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAGGTTTGTAAGGGAGACTTCC -3'
(R):5'- TGCAATAAAAGCATGGTCAGTG -3'

Sequencing Primer
(F):5'- TGTAAGGGAGACTTCCAACTTG -3'
(R):5'- AGGTAACAATTGAAATTAGTCTTGGG -3'
Posted On2016-11-09