Mutagenetix > Incidental Mutation

Incidental Mutation 'R5678:Adgb'

442893

Institutional Source

Beutler Lab

Gene Symbol

Adgb

Ensembl Gene

ENSMUSG00000050994

Gene Name

androglobin

Synonyms

9130014G24Rik

MMRRC Submission

043317-MU

Accession Numbers

MGI:3605549

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5678 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10335703-10472326 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 10431326 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 299 (S299R)

Ref Sequence

ENSEMBL: ENSMUSP00000146658 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045328] [ENSMUST00000132573] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]

AlphaFold

G3UZ78

Predicted Effect

probably benign
Transcript: ENSMUST00000045328

SMART Domains

Protein: ENSMUSP00000045452
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
Blast:CysPc	11	257	1e-165	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000132573
AA Change: S305R

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994
AA Change: S305R

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172530
AA Change: S305R

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: S305R

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART
IQ	904	926	6.41e0	SMART
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1318	1335	N/A	INTRINSIC
coiled coil region	1534	1559	N/A	INTRINSIC
low complexity region	1616	1633	N/A	INTRINSIC
low complexity region	1649	1657	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179956
AA Change: S305R

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: S305R

Domain	Start	End	E-Value	Type
CysPc	56	657	5.36e-2	SMART
IQ	906	928	6.41e0	SMART
low complexity region	1181	1192	N/A	INTRINSIC
low complexity region	1321	1338	N/A	INTRINSIC
coiled coil region	1537	1562	N/A	INTRINSIC
low complexity region	1619	1636	N/A	INTRINSIC
low complexity region	1652	1660	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208717
AA Change: S299R

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

Meta Mutation Damage Score

0.2370

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (55/55)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	T	C	11: 23,516,529	T168A	probably damaging	Het
3425401B19Rik	T	A	14: 32,662,053	R652W	probably damaging	Het
A530016L24Rik	T	G	12: 112,496,872	C43W	probably damaging	Het
Aatk	T	C	11: 120,010,154	T1082A	probably benign	Het
Acsl1	T	A	8: 46,492,850	F7I	probably benign	Het
Apob	T	C	12: 7,991,494	F738L	possibly damaging	Het
Art3	T	C	5: 92,392,550	Y51H	probably damaging	Het
Atr	C	T	9: 95,951,487	Q2597*	probably null	Het
Atrn	T	C	2: 130,970,016	V627A	probably damaging	Het
Baz1a	T	C	12: 54,900,532	K1111E	probably damaging	Het
Ccdc40	T	C	11: 119,231,572	S67P	possibly damaging	Het
Cd164	T	C	10: 41,519,952		probably null	Het
Cep295	T	C	9: 15,322,858	D2214G	probably damaging	Het
Clcn1	A	G	6: 42,307,265	Y589C	probably damaging	Het
Col1a2	C	T	6: 4,536,239	A998V	unknown	Het
Csrnp2	T	C	15: 100,481,804	*535W	probably null	Het
Dhrs7	C	T	12: 72,657,332	G130D	probably damaging	Het
Dnah3	T	C	7: 120,077,851	T477A	probably benign	Het
Dscam	A	G	16: 96,790,900	F725S	probably benign	Het
Dstyk	T	C	1: 132,453,291	V508A	probably benign	Het
Eif4g3	A	G	4: 138,151,742	E595G	probably damaging	Het
Epha6	A	T	16: 59,818,979	V844E	probably damaging	Het
Esrp2	G	A	8: 106,132,118	A629V	probably damaging	Het
Fam208a	CGCGGCGGCGGCGGCGG	CGCGGCGGCGGCGGCGGCGGCGG	14: 27,429,123		probably benign	Het
Fndc3b	A	G	3: 27,429,023	S1009P	probably benign	Het
Gm13762	A	T	2: 88,972,973	L306*	probably null	Het
Gm14124	A	T	2: 150,268,505	R372*	probably null	Het
Gm8257	A	T	14: 44,657,249	I28N	probably damaging	Het
Ighv5-9-1	T	C	12: 113,736,587	E4G	possibly damaging	Het
Ints3	A	G	3: 90,403,548	V455A	probably damaging	Het
Lamtor2	A	G	3: 88,550,794		probably benign	Het
Npy1r	T	C	8: 66,704,203	C92R	probably damaging	Het
Nup210l	T	C	3: 90,190,959	V1406A	probably damaging	Het
Olfr1248	A	G	2: 89,617,281	F304L	probably benign	Het
Olfr978	T	C	9: 39,993,903	V31A	probably benign	Het
Pqlc1	T	C	18: 80,257,034	I40T	probably damaging	Het
Prune2	A	G	19: 17,118,668	D512G	probably damaging	Het
Qdpr	T	C	5: 45,447,637	E43G	possibly damaging	Het
Rps6ka5	T	C	12: 100,724,876	E2G	unknown	Het
Setd2	A	G	9: 110,602,186	T5A	probably damaging	Het
Srpk2	TCA	T	5: 23,524,606		probably null	Het
Sympk	T	C	7: 19,049,472		probably null	Het
Tchh	A	T	3: 93,445,626	Q791L	unknown	Het
Tmed11	T	C	5: 108,786,165	D55G	probably benign	Het
Tnrc18	T	C	5: 142,733,564	D1989G	unknown	Het
Utp20	A	T	10: 88,809,117	H582Q	probably benign	Het
Utrn	A	G	10: 12,442,018	I554T	probably damaging	Het
Zfp119a	T	C	17: 55,868,336	E53G	probably benign	Het

Other mutations in Adgb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Adgb	APN	10	10406099	missense	possibly damaging	0.87
IGL01083:Adgb	APN	10	10407554	missense	possibly damaging	0.50
IGL03064:Adgb	APN	10	10400572	missense	probably benign	0.02
R0080:Adgb	UTSW	10	10377839	splice site	probably benign
R0084:Adgb	UTSW	10	10396344	missense	possibly damaging	0.74
R0112:Adgb	UTSW	10	10407158	splice site	probably benign
R0348:Adgb	UTSW	10	10357879	missense	probably benign
R0415:Adgb	UTSW	10	10431067	splice site	probably null
R0633:Adgb	UTSW	10	10391729	missense	probably benign	0.36
R1052:Adgb	UTSW	10	10442613	missense	probably benign	0.29
R1248:Adgb	UTSW	10	10395310	missense	probably damaging	0.98
R1278:Adgb	UTSW	10	10382828	missense	probably damaging	1.00
R1568:Adgb	UTSW	10	10442665	nonsense	probably null
R1647:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1648:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1663:Adgb	UTSW	10	10339675	missense	possibly damaging	0.86
R1688:Adgb	UTSW	10	10350317	nonsense	probably null
R1758:Adgb	UTSW	10	10426605	missense	probably damaging	1.00
R1772:Adgb	UTSW	10	10382721	splice site	probably benign
R1850:Adgb	UTSW	10	10442502	missense	probably damaging	1.00
R1959:Adgb	UTSW	10	10395249	missense	probably benign	0.02
R1980:Adgb	UTSW	10	10433498	missense	probably benign
R2179:Adgb	UTSW	10	10395274	missense	possibly damaging	0.94
R2229:Adgb	UTSW	10	10436051	missense	probably damaging	1.00
R2283:Adgb	UTSW	10	10377891	missense	probably damaging	0.99
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2875:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2876:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2920:Adgb	UTSW	10	10390243	missense	probably damaging	1.00
R2931:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R3722:Adgb	UTSW	10	10340510	missense	probably benign	0.32
R3846:Adgb	UTSW	10	10382721	splice site	probably benign
R3877:Adgb	UTSW	10	10442483	critical splice donor site	probably null
R4210:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4211:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4333:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R4448:Adgb	UTSW	10	10390825	missense	probably benign	0.32
R4470:Adgb	UTSW	10	10398951	missense	probably benign	0.02
R4624:Adgb	UTSW	10	10403004	missense	probably benign	0.00
R4656:Adgb	UTSW	10	10405306	missense	probably damaging	0.99
R4676:Adgb	UTSW	10	10426710	missense	probably damaging	1.00
R4792:Adgb	UTSW	10	10398903	missense	probably damaging	0.96
R4795:Adgb	UTSW	10	10357872	missense	probably benign	0.01
R4858:Adgb	UTSW	10	10349577	missense	probably damaging	1.00
R4985:Adgb	UTSW	10	10400632	missense	possibly damaging	0.69
R5057:Adgb	UTSW	10	10357978	missense	probably benign	0.11
R5157:Adgb	UTSW	10	10398966	missense	probably damaging	1.00
R5209:Adgb	UTSW	10	10398937	missense	possibly damaging	0.71
R5339:Adgb	UTSW	10	10442606	missense	probably damaging	1.00
R5376:Adgb	UTSW	10	10346563	missense	probably benign	0.09
R5426:Adgb	UTSW	10	10350260	missense	probably benign	0.14
R5516:Adgb	UTSW	10	10431157	missense	probably damaging	1.00
R5554:Adgb	UTSW	10	10340473	missense	probably damaging	0.98
R5707:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5708:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5891:Adgb	UTSW	10	10377847	nonsense	probably null
R5928:Adgb	UTSW	10	10378787	missense	probably damaging	1.00
R6005:Adgb	UTSW	10	10395352	missense	probably damaging	1.00
R6017:Adgb	UTSW	10	10450036	missense	probably damaging	1.00
R6049:Adgb	UTSW	10	10378026	missense	probably damaging	1.00
R6118:Adgb	UTSW	10	10431291	missense	probably damaging	1.00
R6175:Adgb	UTSW	10	10398943	missense	possibly damaging	0.94
R6186:Adgb	UTSW	10	10422758	missense	probably damaging	1.00
R6234:Adgb	UTSW	10	10353080	splice site	probably null
R6383:Adgb	UTSW	10	10450028	missense	probably damaging	1.00
R6522:Adgb	UTSW	10	10377892	nonsense	probably null
R6639:Adgb	UTSW	10	10435956	missense	possibly damaging	0.51
R6697:Adgb	UTSW	10	10406126	nonsense	probably null
R6742:Adgb	UTSW	10	10411849	missense	probably damaging	1.00
R6745:Adgb	UTSW	10	10390197	missense	probably damaging	1.00
R6850:Adgb	UTSW	10	10394574	missense	probably benign	0.39
R7128:Adgb	UTSW	10	10472241	missense	probably benign	0.26
R7326:Adgb	UTSW	10	10400574	missense	possibly damaging	0.80
R7386:Adgb	UTSW	10	10377949	missense	possibly damaging	0.52
R7431:Adgb	UTSW	10	10391955	splice site	probably null
R7569:Adgb	UTSW	10	10431252	missense	probably benign
R7579:Adgb	UTSW	10	10410818	nonsense	probably null
R7582:Adgb	UTSW	10	10390821	missense	probably damaging	1.00
R7615:Adgb	UTSW	10	10436010	missense	probably damaging	0.96
R7692:Adgb	UTSW	10	10411712	critical splice donor site	probably null
R7774:Adgb	UTSW	10	10339660	nonsense	probably null
R7808:Adgb	UTSW	10	10378659	splice site	probably null
R8158:Adgb	UTSW	10	10378734	missense	probably benign	0.22
R8386:Adgb	UTSW	10	10350304	missense	probably damaging	1.00
R8746:Adgb	UTSW	10	10405284	critical splice donor site	probably null
R8785:Adgb	UTSW	10	10357966	missense	probably damaging	1.00
R9089:Adgb	UTSW	10	10442688	missense	probably benign	0.26
R9140:Adgb	UTSW	10	10340519	nonsense	probably null
R9386:Adgb	UTSW	10	10398964	missense	probably benign	0.00
R9777:Adgb	UTSW	10	10407470	missense	possibly damaging	0.74
X0003:Adgb	UTSW	10	10394630	missense	possibly damaging	0.76
Z1176:Adgb	UTSW	10	10378742	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- CAGGTTTGTAAGGGAGACTTCC -3'
(R):5'- TGCAATAAAAGCATGGTCAGTG -3'

Sequencing Primer
(F):5'- TGTAAGGGAGACTTCCAACTTG -3'
(R):5'- AGGTAACAATTGAAATTAGTCTTGGG -3'

Posted On

2016-11-09