Incidental Mutation 'R5678:Baz1a'
ID442901
Institutional Source Beutler Lab
Gene Symbol Baz1a
Ensembl Gene ENSMUSG00000035021
Gene Namebromodomain adjacent to zinc finger domain 1A
SynonymsWcrf180, Acf1, Gtl5
MMRRC Submission 043317-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5678 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location54892989-55014348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54900532 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1111 (K1111E)
Ref Sequence ENSEMBL: ENSMUSP00000039757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038926] [ENSMUST00000173433]
Predicted Effect probably damaging
Transcript: ENSMUST00000038926
AA Change: K1111E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039757
Gene: ENSMUSG00000035021
AA Change: K1111E

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 23 122 4.4e-36 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
Pfam:DDT 423 485 2.3e-14 PFAM
low complexity region 519 530 N/A INTRINSIC
Pfam:WHIM1 593 641 1.5e-8 PFAM
low complexity region 658 696 N/A INTRINSIC
low complexity region 725 738 N/A INTRINSIC
low complexity region 774 796 N/A INTRINSIC
low complexity region 861 873 N/A INTRINSIC
Pfam:WHIM3 894 932 2e-16 PFAM
low complexity region 1058 1073 N/A INTRINSIC
PHD 1151 1197 9.46e-15 SMART
RING 1152 1196 6.88e-1 SMART
low complexity region 1214 1257 N/A INTRINSIC
BROMO 1426 1534 2.18e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173433
AA Change: K1108E

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133478
Gene: ENSMUSG00000035021
AA Change: K1108E

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 122 1.1e-37 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
DDT 422 487 1.54e-19 SMART
low complexity region 518 529 N/A INTRINSIC
Pfam:WHIM1 592 640 1.8e-8 PFAM
low complexity region 657 695 N/A INTRINSIC
low complexity region 722 735 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
PHD 1148 1194 9.46e-15 SMART
RING 1149 1193 6.88e-1 SMART
low complexity region 1211 1254 N/A INTRINSIC
BROMO 1423 1531 2.18e-31 SMART
Meta Mutation Damage Score 0.1225 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The BAZ1A gene encodes the accessory subunit of the ATP-dependent chromatin assembly factor (ACF), a member of the ISWI ('imitation switch') family of chromatin remodeling complexes (summarized by Racki et al., 2009 [PubMed 20033039]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and able to repair meiotic double-strand breaks but exhibit teratospermia, oligospermia, asthenospermia, and male infertility due to impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,516,529 T168A probably damaging Het
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
A530016L24Rik T G 12: 112,496,872 C43W probably damaging Het
Aatk T C 11: 120,010,154 T1082A probably benign Het
Acsl1 T A 8: 46,492,850 F7I probably benign Het
Adgb T G 10: 10,431,326 S299R possibly damaging Het
Apob T C 12: 7,991,494 F738L possibly damaging Het
Art3 T C 5: 92,392,550 Y51H probably damaging Het
Atr C T 9: 95,951,487 Q2597* probably null Het
Atrn T C 2: 130,970,016 V627A probably damaging Het
Ccdc40 T C 11: 119,231,572 S67P possibly damaging Het
Cd164 T C 10: 41,519,952 probably null Het
Cep295 T C 9: 15,322,858 D2214G probably damaging Het
Clcn1 A G 6: 42,307,265 Y589C probably damaging Het
Col1a2 C T 6: 4,536,239 A998V unknown Het
Csrnp2 T C 15: 100,481,804 *535W probably null Het
Dhrs7 C T 12: 72,657,332 G130D probably damaging Het
Dnah3 T C 7: 120,077,851 T477A probably benign Het
Dscam A G 16: 96,790,900 F725S probably benign Het
Dstyk T C 1: 132,453,291 V508A probably benign Het
Eif4g3 A G 4: 138,151,742 E595G probably damaging Het
Epha6 A T 16: 59,818,979 V844E probably damaging Het
Esrp2 G A 8: 106,132,118 A629V probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
Fndc3b A G 3: 27,429,023 S1009P probably benign Het
Gm13762 A T 2: 88,972,973 L306* probably null Het
Gm14124 A T 2: 150,268,505 R372* probably null Het
Gm8257 A T 14: 44,657,249 I28N probably damaging Het
Ighv5-9-1 T C 12: 113,736,587 E4G possibly damaging Het
Ints3 A G 3: 90,403,548 V455A probably damaging Het
Lamtor2 A G 3: 88,550,794 probably benign Het
Npy1r T C 8: 66,704,203 C92R probably damaging Het
Nup210l T C 3: 90,190,959 V1406A probably damaging Het
Olfr1248 A G 2: 89,617,281 F304L probably benign Het
Olfr978 T C 9: 39,993,903 V31A probably benign Het
Pqlc1 T C 18: 80,257,034 I40T probably damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Qdpr T C 5: 45,447,637 E43G possibly damaging Het
Rps6ka5 T C 12: 100,724,876 E2G unknown Het
Setd2 A G 9: 110,602,186 T5A probably damaging Het
Srpk2 TCA T 5: 23,524,606 probably null Het
Sympk T C 7: 19,049,472 probably null Het
Tchh A T 3: 93,445,626 Q791L unknown Het
Tmed11 T C 5: 108,786,165 D55G probably benign Het
Tnrc18 T C 5: 142,733,564 D1989G unknown Het
Utp20 A T 10: 88,809,117 H582Q probably benign Het
Utrn A G 10: 12,442,018 I554T probably damaging Het
Zfp119a T C 17: 55,868,336 E53G probably benign Het
Other mutations in Baz1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Baz1a APN 12 54916731 missense probably benign
IGL01138:Baz1a APN 12 54930325 missense probably damaging 1.00
IGL01298:Baz1a APN 12 54954809 missense probably damaging 1.00
IGL02639:Baz1a APN 12 54896025 splice site probably benign
IGL02995:Baz1a APN 12 54900447 missense probably damaging 1.00
IGL03001:Baz1a APN 12 54923111 missense possibly damaging 0.50
IGL03104:Baz1a APN 12 54894958 missense probably damaging 1.00
IGL03135:Baz1a APN 12 54929590 missense probably damaging 1.00
IGL03151:Baz1a APN 12 54909149 critical splice acceptor site probably null
IGL03235:Baz1a APN 12 54898535 missense probably damaging 1.00
IGL03240:Baz1a APN 12 54927567 nonsense probably null
Flavia UTSW 12 54975308 missense probably damaging 1.00
gumdrops UTSW 12 54900448 missense probably damaging 1.00
Kilter UTSW 12 54900532 missense probably damaging 0.99
Kisses UTSW 12 54975137 missense probably damaging 1.00
Smootch UTSW 12 54911385 missense probably damaging 1.00
PIT4458001:Baz1a UTSW 12 54930310 missense probably benign 0.03
R0127:Baz1a UTSW 12 54898706 missense possibly damaging 0.93
R0183:Baz1a UTSW 12 54911387 missense probably damaging 1.00
R0393:Baz1a UTSW 12 54918436 critical splice donor site probably null
R0532:Baz1a UTSW 12 54934820 missense possibly damaging 0.55
R0614:Baz1a UTSW 12 54941519 nonsense probably null
R0626:Baz1a UTSW 12 54975270 missense probably damaging 0.99
R0654:Baz1a UTSW 12 54911397 missense probably benign 0.01
R0782:Baz1a UTSW 12 54894488 missense probably damaging 1.00
R0826:Baz1a UTSW 12 54930312 nonsense probably null
R0855:Baz1a UTSW 12 54900563 splice site probably benign
R0927:Baz1a UTSW 12 54894988 missense probably damaging 1.00
R0941:Baz1a UTSW 12 54898431 missense probably benign 0.00
R1079:Baz1a UTSW 12 54895000 missense possibly damaging 0.91
R1157:Baz1a UTSW 12 54929564 missense probably damaging 1.00
R1647:Baz1a UTSW 12 54975198 missense probably damaging 1.00
R1731:Baz1a UTSW 12 54918545 missense possibly damaging 0.83
R1739:Baz1a UTSW 12 54898788 nonsense probably null
R1762:Baz1a UTSW 12 54909020 missense probably damaging 1.00
R1770:Baz1a UTSW 12 54898508 missense probably damaging 1.00
R1968:Baz1a UTSW 12 54900337 missense possibly damaging 0.91
R2037:Baz1a UTSW 12 54929646 missense probably damaging 1.00
R2111:Baz1a UTSW 12 54911385 missense probably damaging 1.00
R2215:Baz1a UTSW 12 54975369 nonsense probably null
R2282:Baz1a UTSW 12 54916812 nonsense probably null
R2875:Baz1a UTSW 12 54923119 missense probably damaging 1.00
R2890:Baz1a UTSW 12 54898517 missense probably benign
R2971:Baz1a UTSW 12 54923439 missense probably damaging 1.00
R3404:Baz1a UTSW 12 54916989 missense probably benign 0.00
R3419:Baz1a UTSW 12 54946899 missense probably benign 0.05
R3699:Baz1a UTSW 12 54917046 missense probably benign 0.09
R3899:Baz1a UTSW 12 54934804 missense probably benign 0.01
R3927:Baz1a UTSW 12 54921143 missense possibly damaging 0.68
R4050:Baz1a UTSW 12 54929619 missense probably benign 0.00
R4072:Baz1a UTSW 12 54941560 missense probably benign 0.18
R4196:Baz1a UTSW 12 54911415 missense probably damaging 1.00
R4289:Baz1a UTSW 12 54900448 missense probably damaging 1.00
R4455:Baz1a UTSW 12 54911368 missense probably benign 0.26
R4583:Baz1a UTSW 12 54922540 missense probably damaging 0.99
R4622:Baz1a UTSW 12 54941515 missense probably benign 0.00
R4807:Baz1a UTSW 12 54898482 missense probably benign 0.28
R4998:Baz1a UTSW 12 54975137 missense probably damaging 1.00
R5239:Baz1a UTSW 12 54898344 missense probably damaging 0.99
R5379:Baz1a UTSW 12 54894348 missense probably damaging 1.00
R5408:Baz1a UTSW 12 54923050 missense probably damaging 1.00
R5810:Baz1a UTSW 12 54927715 intron probably benign
R6092:Baz1a UTSW 12 54909083 missense possibly damaging 0.88
R6317:Baz1a UTSW 12 54954800 missense possibly damaging 0.92
R6332:Baz1a UTSW 12 54918554 missense probably benign 0.01
R6803:Baz1a UTSW 12 54941555 missense probably null 0.99
R7185:Baz1a UTSW 12 54975308 missense probably damaging 1.00
R7248:Baz1a UTSW 12 54900508 missense probably damaging 1.00
R7392:Baz1a UTSW 12 54898765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGCACCATGTTTTCAGC -3'
(R):5'- CTCTTTAACATTGGGTGCGG -3'

Sequencing Primer
(F):5'- AGCACCATGTTTTCAGCATCCC -3'
(R):5'- TCTGTTGCAACCCAGGATGAC -3'
Posted On2016-11-09