Incidental Mutation 'R5678:Dhrs7'
ID 442902
Institutional Source Beutler Lab
Gene Symbol Dhrs7
Ensembl Gene ENSMUSG00000021094
Gene Name dehydrogenase/reductase 7
Synonyms 2310016E22Rik, 5730564L20Rik, dehydrogenase/reductase (SDR family) member 7, retDSR4, retSDR4
MMRRC Submission 043317-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R5678 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 72697127-72711678 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 72704106 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 130 (G130D)
Ref Sequence ENSEMBL: ENSMUSP00000021512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021512] [ENSMUST00000220821]
AlphaFold Q9CXR1
Predicted Effect probably damaging
Transcript: ENSMUST00000021512
AA Change: G130D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021512
Gene: ENSMUSG00000021094
AA Change: G130D

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:KR 51 227 2.5e-11 PFAM
Pfam:adh_short 51 250 4.4e-52 PFAM
Pfam:adh_short_C2 57 267 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220821
Predicted Effect unknown
Transcript: ENSMUST00000221750
AA Change: G153D
Meta Mutation Damage Score 0.5393 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) family, which has over 46,000 members. Members in this family are enzymes that metabolize many different compounds, such as steroid hormones, prostaglandins, retinoids, lipids and xenobiotics. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,466,529 (GRCm39) T168A probably damaging Het
3425401B19Rik T A 14: 32,384,010 (GRCm39) R652W probably damaging Het
A530016L24Rik T G 12: 112,463,306 (GRCm39) C43W probably damaging Het
Aatk T C 11: 119,900,980 (GRCm39) T1082A probably benign Het
Acsl1 T A 8: 46,945,887 (GRCm39) F7I probably benign Het
Adgb T G 10: 10,307,070 (GRCm39) S299R possibly damaging Het
Apob T C 12: 8,041,494 (GRCm39) F738L possibly damaging Het
Art3 T C 5: 92,540,409 (GRCm39) Y51H probably damaging Het
Atr C T 9: 95,833,540 (GRCm39) Q2597* probably null Het
Atrn T C 2: 130,811,936 (GRCm39) V627A probably damaging Het
Baz1a T C 12: 54,947,317 (GRCm39) K1111E probably damaging Het
Ccdc40 T C 11: 119,122,398 (GRCm39) S67P possibly damaging Het
Cd164 T C 10: 41,395,948 (GRCm39) probably null Het
Cep295 T C 9: 15,234,154 (GRCm39) D2214G probably damaging Het
Clcn1 A G 6: 42,284,199 (GRCm39) Y589C probably damaging Het
Col1a2 C T 6: 4,536,239 (GRCm39) A998V unknown Het
Csrnp2 T C 15: 100,379,685 (GRCm39) *535W probably null Het
Dnah3 T C 7: 119,677,074 (GRCm39) T477A probably benign Het
Dscam A G 16: 96,592,100 (GRCm39) F725S probably benign Het
Dstyk T C 1: 132,381,029 (GRCm39) V508A probably benign Het
Eif4g3 A G 4: 137,879,053 (GRCm39) E595G probably damaging Het
Epha6 A T 16: 59,639,342 (GRCm39) V844E probably damaging Het
Esrp2 G A 8: 106,858,750 (GRCm39) A629V probably damaging Het
Fndc3b A G 3: 27,483,172 (GRCm39) S1009P probably benign Het
Gm8257 A T 14: 44,894,706 (GRCm39) I28N probably damaging Het
Ighv5-9-1 T C 12: 113,700,207 (GRCm39) E4G possibly damaging Het
Ints3 A G 3: 90,310,855 (GRCm39) V455A probably damaging Het
Lamtor2 A G 3: 88,458,101 (GRCm39) probably benign Het
Npy1r T C 8: 67,156,855 (GRCm39) C92R probably damaging Het
Nup210l T C 3: 90,098,266 (GRCm39) V1406A probably damaging Het
Or10g7 T C 9: 39,905,199 (GRCm39) V31A probably benign Het
Or4a75 A G 2: 89,447,625 (GRCm39) F304L probably benign Het
Or4c108 A T 2: 88,803,317 (GRCm39) L306* probably null Het
Prune2 A G 19: 17,096,032 (GRCm39) D512G probably damaging Het
Qdpr T C 5: 45,604,979 (GRCm39) E43G possibly damaging Het
Rps6ka5 T C 12: 100,691,135 (GRCm39) E2G unknown Het
Setd2 A G 9: 110,431,254 (GRCm39) T5A probably damaging Het
Slc66a2 T C 18: 80,300,249 (GRCm39) I40T probably damaging Het
Srpk2 TCA T 5: 23,729,604 (GRCm39) probably null Het
Sympk T C 7: 18,783,397 (GRCm39) probably null Het
Tasor CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,151,080 (GRCm39) probably benign Het
Tchh A T 3: 93,352,933 (GRCm39) Q791L unknown Het
Tmed11 T C 5: 108,934,031 (GRCm39) D55G probably benign Het
Tnrc18 T C 5: 142,719,319 (GRCm39) D1989G unknown Het
Utp20 A T 10: 88,644,979 (GRCm39) H582Q probably benign Het
Utrn A G 10: 12,317,762 (GRCm39) I554T probably damaging Het
Zfp1005 A T 2: 150,110,425 (GRCm39) R372* probably null Het
Zfp119a T C 17: 56,175,336 (GRCm39) E53G probably benign Het
Other mutations in Dhrs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dhrs7 APN 12 72,706,124 (GRCm39) missense probably damaging 1.00
IGL00715:Dhrs7 APN 12 72,699,164 (GRCm39) missense probably damaging 1.00
IGL02398:Dhrs7 APN 12 72,711,466 (GRCm39) missense probably damaging 1.00
R0421:Dhrs7 UTSW 12 72,699,860 (GRCm39) splice site probably benign
R0691:Dhrs7 UTSW 12 72,699,125 (GRCm39) missense probably damaging 1.00
R1640:Dhrs7 UTSW 12 72,699,089 (GRCm39) missense possibly damaging 0.86
R1696:Dhrs7 UTSW 12 72,699,894 (GRCm39) missense possibly damaging 0.88
R1727:Dhrs7 UTSW 12 72,706,238 (GRCm39) missense probably damaging 1.00
R1791:Dhrs7 UTSW 12 72,699,939 (GRCm39) missense probably benign 0.13
R2046:Dhrs7 UTSW 12 72,699,040 (GRCm39) missense possibly damaging 0.47
R2124:Dhrs7 UTSW 12 72,699,951 (GRCm39) missense probably damaging 1.00
R2205:Dhrs7 UTSW 12 72,703,144 (GRCm39) missense probably damaging 1.00
R2356:Dhrs7 UTSW 12 72,699,155 (GRCm39) missense probably benign 0.00
R3431:Dhrs7 UTSW 12 72,711,501 (GRCm39) missense probably damaging 0.99
R4492:Dhrs7 UTSW 12 72,699,899 (GRCm39) missense probably damaging 1.00
R4744:Dhrs7 UTSW 12 72,699,025 (GRCm39) missense possibly damaging 0.94
R4747:Dhrs7 UTSW 12 72,699,892 (GRCm39) missense probably benign 0.03
R5050:Dhrs7 UTSW 12 72,704,184 (GRCm39) missense probably damaging 1.00
R5076:Dhrs7 UTSW 12 72,706,255 (GRCm39) missense probably benign 0.00
R6361:Dhrs7 UTSW 12 72,711,433 (GRCm39) missense probably damaging 0.98
R7895:Dhrs7 UTSW 12 72,699,234 (GRCm39) splice site probably null
R8432:Dhrs7 UTSW 12 72,711,581 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGCAGATATTAACTTCACCCTTG -3'
(R):5'- TGCTTAGGTAGTGCCTCCTG -3'

Sequencing Primer
(F):5'- CACCCTTGCTTCTTGGGG -3'
(R):5'- TCCTGGAGTGGGTTCACC -3'
Posted On 2016-11-09