Incidental Mutation 'R5678:Ighv5-9-1'
ID 442905
Institutional Source Beutler Lab
Gene Symbol Ighv5-9-1
Ensembl Gene ENSMUSG00000095210
Gene Name immunoglobulin heavy variable 5-9-1
Synonyms Gm16886
MMRRC Submission 043317-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock # R5678 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 113736111-113736630 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113736587 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 4 (E4G)
Ref Sequence ENSEMBL: ENSMUSP00000141243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103452] [ENSMUST00000192264]
AlphaFold A0A075B5Q6
Predicted Effect probably benign
Transcript: ENSMUST00000103452
SMART Domains Protein: ENSMUSP00000100233
Gene: ENSMUSG00000095210

DomainStartEndE-ValueType
IGv 35 116 8.34e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192264
AA Change: E4G

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141243
Gene: ENSMUSG00000095210
AA Change: E4G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGv 45 126 3.3e-35 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,516,529 T168A probably damaging Het
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
A530016L24Rik T G 12: 112,496,872 C43W probably damaging Het
Aatk T C 11: 120,010,154 T1082A probably benign Het
Acsl1 T A 8: 46,492,850 F7I probably benign Het
Adgb T G 10: 10,431,326 S299R possibly damaging Het
Apob T C 12: 7,991,494 F738L possibly damaging Het
Art3 T C 5: 92,392,550 Y51H probably damaging Het
Atr C T 9: 95,951,487 Q2597* probably null Het
Atrn T C 2: 130,970,016 V627A probably damaging Het
Baz1a T C 12: 54,900,532 K1111E probably damaging Het
Ccdc40 T C 11: 119,231,572 S67P possibly damaging Het
Cd164 T C 10: 41,519,952 probably null Het
Cep295 T C 9: 15,322,858 D2214G probably damaging Het
Clcn1 A G 6: 42,307,265 Y589C probably damaging Het
Col1a2 C T 6: 4,536,239 A998V unknown Het
Csrnp2 T C 15: 100,481,804 *535W probably null Het
Dhrs7 C T 12: 72,657,332 G130D probably damaging Het
Dnah3 T C 7: 120,077,851 T477A probably benign Het
Dscam A G 16: 96,790,900 F725S probably benign Het
Dstyk T C 1: 132,453,291 V508A probably benign Het
Eif4g3 A G 4: 138,151,742 E595G probably damaging Het
Epha6 A T 16: 59,818,979 V844E probably damaging Het
Esrp2 G A 8: 106,132,118 A629V probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
Fndc3b A G 3: 27,429,023 S1009P probably benign Het
Gm13762 A T 2: 88,972,973 L306* probably null Het
Gm14124 A T 2: 150,268,505 R372* probably null Het
Gm8257 A T 14: 44,657,249 I28N probably damaging Het
Ints3 A G 3: 90,403,548 V455A probably damaging Het
Lamtor2 A G 3: 88,550,794 probably benign Het
Npy1r T C 8: 66,704,203 C92R probably damaging Het
Nup210l T C 3: 90,190,959 V1406A probably damaging Het
Olfr1248 A G 2: 89,617,281 F304L probably benign Het
Olfr978 T C 9: 39,993,903 V31A probably benign Het
Pqlc1 T C 18: 80,257,034 I40T probably damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Qdpr T C 5: 45,447,637 E43G possibly damaging Het
Rps6ka5 T C 12: 100,724,876 E2G unknown Het
Setd2 A G 9: 110,602,186 T5A probably damaging Het
Srpk2 TCA T 5: 23,524,606 probably null Het
Sympk T C 7: 19,049,472 probably null Het
Tchh A T 3: 93,445,626 Q791L unknown Het
Tmed11 T C 5: 108,786,165 D55G probably benign Het
Tnrc18 T C 5: 142,733,564 D1989G unknown Het
Utp20 A T 10: 88,809,117 H582Q probably benign Het
Utrn A G 10: 12,442,018 I554T probably damaging Het
Zfp119a T C 17: 55,868,336 E53G probably benign Het
Other mutations in Ighv5-9-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Ighv5-9-1 APN 12 113736390 missense probably damaging 1.00
R4921:Ighv5-9-1 UTSW 12 113736294 missense possibly damaging 0.61
R5161:Ighv5-9-1 UTSW 12 113736157 missense possibly damaging 0.70
R5559:Ighv5-9-1 UTSW 12 113736125 nonsense probably null
R7529:Ighv5-9-1 UTSW 12 113736334 missense possibly damaging 0.91
R7618:Ighv5-9-1 UTSW 12 113736199 missense probably damaging 0.99
R7791:Ighv5-9-1 UTSW 12 113736545 missense probably damaging 0.99
R9272:Ighv5-9-1 UTSW 12 113736198 missense probably damaging 1.00
R9331:Ighv5-9-1 UTSW 12 113736258 missense possibly damaging 0.80
Z1088:Ighv5-9-1 UTSW 12 113736120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATCCAGAGGCTGCACAG -3'
(R):5'- TGGTAACATCAGTGGCATCAG -3'

Sequencing Primer
(F):5'- AGCTTCACGTCACACTGG -3'
(R):5'- GCATCAGCCTAGGTCCAAC -3'
Posted On 2016-11-09