Mutagenetix > Incidental Mutations

Incidental Mutation 'R5678:3425401B19Rik'

442908

Institutional Source

Beutler Lab

Gene Symbol

3425401B19Rik

Ensembl Gene

ENSMUSG00000071540

Gene Name

RIKEN cDNA 3425401B19 gene

Synonyms

MMRRC Submission

043317-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R5678 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32659119-32685293 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32662053 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 652 (R652W)

Ref Sequence

ENSEMBL: ENSMUSP00000093741 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096038]

Predicted Effect

probably damaging
Transcript: ENSMUST00000096038
AA Change: R652W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: R652W

Domain	Start	End	E-Value	Type
low complexity region	135	145	N/A	INTRINSIC
low complexity region	162	175	N/A	INTRINSIC
low complexity region	386	399	N/A	INTRINSIC
low complexity region	587	602	N/A	INTRINSIC
low complexity region	605	624	N/A	INTRINSIC
low complexity region	728	744	N/A	INTRINSIC
low complexity region	1002	1015	N/A	INTRINSIC
low complexity region	1086	1097	N/A	INTRINSIC
low complexity region	1147	1158	N/A	INTRINSIC
low complexity region	1161	1176	N/A	INTRINSIC
Pfam:DUF4585	1251	1322	6.5e-30	PFAM

Meta Mutation Damage Score

0.2548

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (55/55)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	T	C	11: 23,516,529	T168A	probably damaging	Het
A530016L24Rik	T	G	12: 112,496,872	C43W	probably damaging	Het
Aatk	T	C	11: 120,010,154	T1082A	probably benign	Het
Acsl1	T	A	8: 46,492,850	F7I	probably benign	Het
Adgb	T	G	10: 10,431,326	S299R	possibly damaging	Het
Apob	T	C	12: 7,991,494	F738L	possibly damaging	Het
Art3	T	C	5: 92,392,550	Y51H	probably damaging	Het
Atr	C	T	9: 95,951,487	Q2597*	probably null	Het
Atrn	T	C	2: 130,970,016	V627A	probably damaging	Het
Baz1a	T	C	12: 54,900,532	K1111E	probably damaging	Het
Ccdc40	T	C	11: 119,231,572	S67P	possibly damaging	Het
Cd164	T	C	10: 41,519,952		probably null	Het
Cep295	T	C	9: 15,322,858	D2214G	probably damaging	Het
Clcn1	A	G	6: 42,307,265	Y589C	probably damaging	Het
Col1a2	C	T	6: 4,536,239	A998V	unknown	Het
Csrnp2	T	C	15: 100,481,804	*535W	probably null	Het
Dhrs7	C	T	12: 72,657,332	G130D	probably damaging	Het
Dnah3	T	C	7: 120,077,851	T477A	probably benign	Het
Dscam	A	G	16: 96,790,900	F725S	probably benign	Het
Dstyk	T	C	1: 132,453,291	V508A	probably benign	Het
Eif4g3	A	G	4: 138,151,742	E595G	probably damaging	Het
Epha6	A	T	16: 59,818,979	V844E	probably damaging	Het
Esrp2	G	A	8: 106,132,118	A629V	probably damaging	Het
Fam208a	CGCGGCGGCGGCGGCGG	CGCGGCGGCGGCGGCGGCGGCGG	14: 27,429,123		probably benign	Het
Fndc3b	A	G	3: 27,429,023	S1009P	probably benign	Het
Gm13762	A	T	2: 88,972,973	L306*	probably null	Het
Gm14124	A	T	2: 150,268,505	R372*	probably null	Het
Gm8257	A	T	14: 44,657,249	I28N	probably damaging	Het
Ighv5-9-1	T	C	12: 113,736,587	E4G	possibly damaging	Het
Ints3	A	G	3: 90,403,548	V455A	probably damaging	Het
Lamtor2	A	G	3: 88,550,794		probably benign	Het
Npy1r	T	C	8: 66,704,203	C92R	probably damaging	Het
Nup210l	T	C	3: 90,190,959	V1406A	probably damaging	Het
Olfr1248	A	G	2: 89,617,281	F304L	probably benign	Het
Olfr978	T	C	9: 39,993,903	V31A	probably benign	Het
Pqlc1	T	C	18: 80,257,034	I40T	probably damaging	Het
Prune2	A	G	19: 17,118,668	D512G	probably damaging	Het
Qdpr	T	C	5: 45,447,637	E43G	possibly damaging	Het
Rps6ka5	T	C	12: 100,724,876	E2G	unknown	Het
Setd2	A	G	9: 110,602,186	T5A	probably damaging	Het
Srpk2	TCA	T	5: 23,524,606		probably null	Het
Sympk	T	C	7: 19,049,472		probably null	Het
Tchh	A	T	3: 93,445,626	Q791L	unknown	Het
Tmed11	T	C	5: 108,786,165	D55G	probably benign	Het
Tnrc18	T	C	5: 142,733,564	D1989G	unknown	Het
Utp20	A	T	10: 88,809,117	H582Q	probably benign	Het
Utrn	A	G	10: 12,442,018	I554T	probably damaging	Het
Zfp119a	T	C	17: 55,868,336	E53G	probably benign	Het

Other mutations in 3425401B19Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:3425401B19Rik	APN	14	32660916	missense	probably benign	0.18
IGL00844:3425401B19Rik	APN	14	32662999	nonsense	probably null
IGL01292:3425401B19Rik	APN	14	32660874	missense	probably benign	0.18
IGL01295:3425401B19Rik	APN	14	32661936	missense	possibly damaging	0.53
IGL01457:3425401B19Rik	APN	14	32660951	missense	probably benign
IGL01470:3425401B19Rik	APN	14	32660457	missense	possibly damaging	0.53
IGL01612:3425401B19Rik	APN	14	32660031	missense	possibly damaging	0.53
IGL01974:3425401B19Rik	APN	14	32659805	missense	possibly damaging	0.85
IGL02095:3425401B19Rik	APN	14	32661626	missense	probably benign	0.33
IGL02138:3425401B19Rik	APN	14	32662715	missense	possibly damaging	0.83
IGL02178:3425401B19Rik	APN	14	32662461	missense	possibly damaging	0.83
IGL02245:3425401B19Rik	APN	14	32659815	missense	probably benign	0.03
IGL02529:3425401B19Rik	APN	14	32661233	missense	probably benign
IGL03401:3425401B19Rik	APN	14	32662266	nonsense	probably null
PIT4515001:3425401B19Rik	UTSW	14	32661111	nonsense	probably null
R0233:3425401B19Rik	UTSW	14	32663373	missense	probably benign
R0233:3425401B19Rik	UTSW	14	32663373	missense	probably benign
R0320:3425401B19Rik	UTSW	14	32662614	missense	probably benign	0.19
R0519:3425401B19Rik	UTSW	14	32662962	missense	possibly damaging	0.92
R0551:3425401B19Rik	UTSW	14	32662641	missense	probably benign	0.03
R0759:3425401B19Rik	UTSW	14	32662497	missense	possibly damaging	0.93
R0831:3425401B19Rik	UTSW	14	32662271	missense	probably benign	0.01
R1124:3425401B19Rik	UTSW	14	32662082	missense	possibly damaging	0.53
R1346:3425401B19Rik	UTSW	14	32660814	missense	probably benign	0.07
R1997:3425401B19Rik	UTSW	14	32660048	missense	possibly damaging	0.71
R2055:3425401B19Rik	UTSW	14	32662551	missense	probably benign
R2212:3425401B19Rik	UTSW	14	32661602	missense	probably benign	0.33
R2416:3425401B19Rik	UTSW	14	32663834	missense	probably benign	0.04
R2441:3425401B19Rik	UTSW	14	32663492	missense	possibly damaging	0.53
R2513:3425401B19Rik	UTSW	14	32661852	missense	possibly damaging	0.53
R3414:3425401B19Rik	UTSW	14	32661602	missense	probably benign	0.33
R3800:3425401B19Rik	UTSW	14	32663068	missense	possibly damaging	0.83
R3809:3425401B19Rik	UTSW	14	32663693	missense	possibly damaging	0.96
R4166:3425401B19Rik	UTSW	14	32660955	missense	possibly damaging	0.53
R4581:3425401B19Rik	UTSW	14	32661871	missense	possibly damaging	0.73
R4721:3425401B19Rik	UTSW	14	32663150	missense	probably benign	0.01
R4769:3425401B19Rik	UTSW	14	32660217	missense	probably benign	0.32
R4809:3425401B19Rik	UTSW	14	32662631	missense	probably benign	0.19
R4919:3425401B19Rik	UTSW	14	32663288	missense	possibly damaging	0.85
R4925:3425401B19Rik	UTSW	14	32663180	missense	possibly damaging	0.86
R4972:3425401B19Rik	UTSW	14	32661404	missense	possibly damaging	0.73
R5068:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5069:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5070:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5258:3425401B19Rik	UTSW	14	32663309	missense	probably damaging	0.98
R5435:3425401B19Rik	UTSW	14	32661456	missense	probably benign	0.18
R5549:3425401B19Rik	UTSW	14	32663036	missense	possibly damaging	0.68
R5680:3425401B19Rik	UTSW	14	32662053	missense	probably damaging	0.97
R5872:3425401B19Rik	UTSW	14	32660352	missense	possibly damaging	0.73
R5896:3425401B19Rik	UTSW	14	32661675	nonsense	probably null
R5940:3425401B19Rik	UTSW	14	32662688	missense	possibly damaging	0.91
R6044:3425401B19Rik	UTSW	14	32660657	missense	possibly damaging	0.53
R6136:3425401B19Rik	UTSW	14	32662282	missense	possibly damaging	0.70
R6277:3425401B19Rik	UTSW	14	32663694	missense	possibly damaging	0.86
R6385:3425401B19Rik	UTSW	14	32661279	missense	probably benign	0.01
R6728:3425401B19Rik	UTSW	14	32662688	missense	possibly damaging	0.91
R6984:3425401B19Rik	UTSW	14	32661980	missense	probably benign	0.00
R7047:3425401B19Rik	UTSW	14	32660174	missense	possibly damaging	0.89
R7249:3425401B19Rik	UTSW	14	32663314	missense	possibly damaging	0.73
R7493:3425401B19Rik	UTSW	14	32663300	missense	possibly damaging	0.96
R7575:3425401B19Rik	UTSW	14	32662632	missense	probably benign	0.03
R7742:3425401B19Rik	UTSW	14	32662757	missense	possibly damaging	0.68
R7747:3425401B19Rik	UTSW	14	32663069	missense	possibly damaging	0.83
R7784:3425401B19Rik	UTSW	14	32659840	missense	probably benign	0.00
R8098:3425401B19Rik	UTSW	14	32662661	missense	probably damaging	0.99
R8111:3425401B19Rik	UTSW	14	32660309	nonsense	probably null
R8171:3425401B19Rik	UTSW	14	32662025	missense	probably benign
R8276:3425401B19Rik	UTSW	14	32663928	missense	probably damaging	0.97
R8330:3425401B19Rik	UTSW	14	32659793	missense	probably damaging	0.98
R8422:3425401B19Rik	UTSW	14	32662297	missense	possibly damaging	0.84
R8464:3425401B19Rik	UTSW	14	32659977	missense	possibly damaging	0.53
X0025:3425401B19Rik	UTSW	14	32662469	missense	probably damaging	0.98
Z1177:3425401B19Rik	UTSW	14	32659808	missense	possibly damaging	0.86
Z1177:3425401B19Rik	UTSW	14	32661398	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTGTCGCTGTAAAACACATCCTC -3'
(R):5'- AGAGAATCCTTTGCAGTCAGCC -3'

Sequencing Primer
(F):5'- TCCTCCTCAGGGGAAAGG -3'
(R):5'- TTTGCAGTCAGCCACCCG -3'

Posted On

2016-11-09