Incidental Mutation 'R5678:Csrnp2'
ID442909
Institutional Source Beutler Lab
Gene Symbol Csrnp2
Ensembl Gene ENSMUSG00000044636
Gene Namecysteine-serine-rich nuclear protein 2
SynonymsCSRNP-2
MMRRC Submission 043317-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5678 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100479570-100495488 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 100481804 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 535 (*535W)
Ref Sequence ENSEMBL: ENSMUSP00000052144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037001] [ENSMUST00000061457] [ENSMUST00000229012] [ENSMUST00000229648] [ENSMUST00000230294]
Predicted Effect probably benign
Transcript: ENSMUST00000037001
SMART Domains Protein: ENSMUSP00000037546
Gene: ENSMUSG00000037353

DomainStartEndE-ValueType
Pfam:LETM1 78 346 1.5e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000061457
AA Change: *535W
SMART Domains Protein: ENSMUSP00000052144
Gene: ENSMUSG00000044636
AA Change: *535W

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:CSRNP_N 61 280 5e-106 PFAM
low complexity region 330 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229596
Predicted Effect probably benign
Transcript: ENSMUST00000229648
Predicted Effect probably benign
Transcript: ENSMUST00000230294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231001
Meta Mutation Damage Score 0.8618 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CSRNP family of nuclear proteins that share conserved regions, including cysteine- and serine- rich regions, a basic domain, a transcriptional activation domain, and bind the sequence 'AGAGTG', thus have the hallmark of transcription factors. Studies in mice suggest that these genes may have redundant functions. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and healthy and display normal development, hematopoiesis and T cell function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,516,529 T168A probably damaging Het
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
A530016L24Rik T G 12: 112,496,872 C43W probably damaging Het
Aatk T C 11: 120,010,154 T1082A probably benign Het
Acsl1 T A 8: 46,492,850 F7I probably benign Het
Adgb T G 10: 10,431,326 S299R possibly damaging Het
Apob T C 12: 7,991,494 F738L possibly damaging Het
Art3 T C 5: 92,392,550 Y51H probably damaging Het
Atr C T 9: 95,951,487 Q2597* probably null Het
Atrn T C 2: 130,970,016 V627A probably damaging Het
Baz1a T C 12: 54,900,532 K1111E probably damaging Het
Ccdc40 T C 11: 119,231,572 S67P possibly damaging Het
Cd164 T C 10: 41,519,952 probably null Het
Cep295 T C 9: 15,322,858 D2214G probably damaging Het
Clcn1 A G 6: 42,307,265 Y589C probably damaging Het
Col1a2 C T 6: 4,536,239 A998V unknown Het
Dhrs7 C T 12: 72,657,332 G130D probably damaging Het
Dnah3 T C 7: 120,077,851 T477A probably benign Het
Dscam A G 16: 96,790,900 F725S probably benign Het
Dstyk T C 1: 132,453,291 V508A probably benign Het
Eif4g3 A G 4: 138,151,742 E595G probably damaging Het
Epha6 A T 16: 59,818,979 V844E probably damaging Het
Esrp2 G A 8: 106,132,118 A629V probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
Fndc3b A G 3: 27,429,023 S1009P probably benign Het
Gm13762 A T 2: 88,972,973 L306* probably null Het
Gm14124 A T 2: 150,268,505 R372* probably null Het
Gm8257 A T 14: 44,657,249 I28N probably damaging Het
Ighv5-9-1 T C 12: 113,736,587 E4G possibly damaging Het
Ints3 A G 3: 90,403,548 V455A probably damaging Het
Lamtor2 A G 3: 88,550,794 probably benign Het
Npy1r T C 8: 66,704,203 C92R probably damaging Het
Nup210l T C 3: 90,190,959 V1406A probably damaging Het
Olfr1248 A G 2: 89,617,281 F304L probably benign Het
Olfr978 T C 9: 39,993,903 V31A probably benign Het
Pqlc1 T C 18: 80,257,034 I40T probably damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Qdpr T C 5: 45,447,637 E43G possibly damaging Het
Rps6ka5 T C 12: 100,724,876 E2G unknown Het
Setd2 A G 9: 110,602,186 T5A probably damaging Het
Srpk2 TCA T 5: 23,524,606 probably null Het
Sympk T C 7: 19,049,472 probably null Het
Tchh A T 3: 93,445,626 Q791L unknown Het
Tmed11 T C 5: 108,786,165 D55G probably benign Het
Tnrc18 T C 5: 142,733,564 D1989G unknown Het
Utp20 A T 10: 88,809,117 H582Q probably benign Het
Utrn A G 10: 12,442,018 I554T probably damaging Het
Zfp119a T C 17: 55,868,336 E53G probably benign Het
Other mutations in Csrnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Csrnp2 APN 15 100484643 missense probably benign 0.21
R0674:Csrnp2 UTSW 15 100487991 missense probably damaging 1.00
R1988:Csrnp2 UTSW 15 100489440 missense probably damaging 1.00
R3683:Csrnp2 UTSW 15 100481998 missense probably benign
R4688:Csrnp2 UTSW 15 100482360 missense probably damaging 0.97
R4846:Csrnp2 UTSW 15 100484690 missense probably damaging 1.00
R5429:Csrnp2 UTSW 15 100482054 missense probably benign
R6056:Csrnp2 UTSW 15 100482382 missense probably benign 0.23
R6765:Csrnp2 UTSW 15 100482693 missense probably damaging 1.00
R6925:Csrnp2 UTSW 15 100481958 missense probably benign 0.03
R7513:Csrnp2 UTSW 15 100482416 missense probably benign 0.10
R7697:Csrnp2 UTSW 15 100488072 missense probably damaging 1.00
R8081:Csrnp2 UTSW 15 100489581 missense probably damaging 0.98
X0020:Csrnp2 UTSW 15 100484703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTTTGTTCTGGCGGCC -3'
(R):5'- TCAGCTGCTCTCTGTAAGCC -3'

Sequencing Primer
(F):5'- GCCCAGAGAGCTCGGTAC -3'
(R):5'- AAACTCCTGCCCGAGGACTG -3'
Posted On2016-11-09