Mutagenetix > Incidental Mutations

Incidental Mutation 'R5678:Epha6'

442910

Institutional Source

Beutler Lab

Gene Symbol

Epha6

Ensembl Gene

ENSMUSG00000055540

Gene Name

Eph receptor A6

Synonyms

m-ehk2, Hek12, Ehk2

MMRRC Submission

043317-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5678 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59653483-60605531 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59818979 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 844 (V844E)

Ref Sequence

ENSEMBL: ENSMUSP00000066734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068860] [ENSMUST00000161358]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000068860
AA Change: V844E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: V844E

Domain	Start	End	E-Value	Type
low complexity region	4	37	N/A	INTRINSIC
low complexity region	79	90	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
EPH_lbd	128	301	5.95e-125	SMART
Pfam:GCC2_GCC3	361	406	1.6e-8	PFAM
FN3	426	518	5.83e-3	SMART
FN3	537	618	2.19e-7	SMART
Pfam:EphA2_TM	644	722	1.8e-22	PFAM
TyrKc	725	1024	3.66e-122	SMART
SAM	1052	1119	1.24e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161358

SMART Domains

Protein: ENSMUSP00000124340
Gene: ENSMUSG00000055540

Domain	Start	End	E-Value	Type
Pfam:EphA2_TM	9	88	1.2e-26	PFAM
Pfam:Pkinase_Tyr	91	183	3e-18	PFAM
Pfam:Pkinase	91	296	1.5e-29	PFAM
Pfam:Pkinase_Tyr	179	295	6e-31	PFAM

Meta Mutation Damage Score

0.3076

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	T	C	11: 23,516,529	T168A	probably damaging	Het
3425401B19Rik	T	A	14: 32,662,053	R652W	probably damaging	Het
A530016L24Rik	T	G	12: 112,496,872	C43W	probably damaging	Het
Aatk	T	C	11: 120,010,154	T1082A	probably benign	Het
Acsl1	T	A	8: 46,492,850	F7I	probably benign	Het
Adgb	T	G	10: 10,431,326	S299R	possibly damaging	Het
Apob	T	C	12: 7,991,494	F738L	possibly damaging	Het
Art3	T	C	5: 92,392,550	Y51H	probably damaging	Het
Atr	C	T	9: 95,951,487	Q2597*	probably null	Het
Atrn	T	C	2: 130,970,016	V627A	probably damaging	Het
Baz1a	T	C	12: 54,900,532	K1111E	probably damaging	Het
Ccdc40	T	C	11: 119,231,572	S67P	possibly damaging	Het
Cd164	T	C	10: 41,519,952		probably null	Het
Cep295	T	C	9: 15,322,858	D2214G	probably damaging	Het
Clcn1	A	G	6: 42,307,265	Y589C	probably damaging	Het
Col1a2	C	T	6: 4,536,239	A998V	unknown	Het
Csrnp2	T	C	15: 100,481,804	*535W	probably null	Het
Dhrs7	C	T	12: 72,657,332	G130D	probably damaging	Het
Dnah3	T	C	7: 120,077,851	T477A	probably benign	Het
Dscam	A	G	16: 96,790,900	F725S	probably benign	Het
Dstyk	T	C	1: 132,453,291	V508A	probably benign	Het
Eif4g3	A	G	4: 138,151,742	E595G	probably damaging	Het
Esrp2	G	A	8: 106,132,118	A629V	probably damaging	Het
Fam208a	CGCGGCGGCGGCGGCGG	CGCGGCGGCGGCGGCGGCGGCGG	14: 27,429,123		probably benign	Het
Fndc3b	A	G	3: 27,429,023	S1009P	probably benign	Het
Gm13762	A	T	2: 88,972,973	L306*	probably null	Het
Gm14124	A	T	2: 150,268,505	R372*	probably null	Het
Gm8257	A	T	14: 44,657,249	I28N	probably damaging	Het
Ighv5-9-1	T	C	12: 113,736,587	E4G	possibly damaging	Het
Ints3	A	G	3: 90,403,548	V455A	probably damaging	Het
Lamtor2	A	G	3: 88,550,794		probably benign	Het
Npy1r	T	C	8: 66,704,203	C92R	probably damaging	Het
Nup210l	T	C	3: 90,190,959	V1406A	probably damaging	Het
Olfr1248	A	G	2: 89,617,281	F304L	probably benign	Het
Olfr978	T	C	9: 39,993,903	V31A	probably benign	Het
Pqlc1	T	C	18: 80,257,034	I40T	probably damaging	Het
Prune2	A	G	19: 17,118,668	D512G	probably damaging	Het
Qdpr	T	C	5: 45,447,637	E43G	possibly damaging	Het
Rps6ka5	T	C	12: 100,724,876	E2G	unknown	Het
Setd2	A	G	9: 110,602,186	T5A	probably damaging	Het
Srpk2	TCA	T	5: 23,524,606		probably null	Het
Sympk	T	C	7: 19,049,472		probably null	Het
Tchh	A	T	3: 93,445,626	Q791L	unknown	Het
Tmed11	T	C	5: 108,786,165	D55G	probably benign	Het
Tnrc18	T	C	5: 142,733,564	D1989G	unknown	Het
Utp20	A	T	10: 88,809,117	H582Q	probably benign	Het
Utrn	A	G	10: 12,442,018	I554T	probably damaging	Het
Zfp119a	T	C	17: 55,868,336	E53G	probably benign	Het

Other mutations in Epha6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00475:Epha6	APN	16	59915962	missense	probably damaging	1.00
IGL00849:Epha6	APN	16	60425111	missense	possibly damaging	0.89
IGL00898:Epha6	APN	16	59775541	critical splice donor site	probably null
IGL01353:Epha6	APN	16	60424895	missense	probably damaging	1.00
IGL01409:Epha6	APN	16	59655737	nonsense	probably null
IGL01577:Epha6	APN	16	59956926	missense	possibly damaging	0.57
IGL01653:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01654:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01655:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01657:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01663:Epha6	APN	16	59775644	missense	probably damaging	1.00
IGL01899:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL02272:Epha6	APN	16	59818937	missense	probably damaging	1.00
IGL03265:Epha6	APN	16	60060231	splice site	probably benign
IGL03333:Epha6	APN	16	59682688	missense	probably damaging	1.00
rauwulfia	UTSW	16	59682616	missense	probably damaging	1.00
PIT4377001:Epha6	UTSW	16	60205552	missense	probably damaging	0.98
R0505:Epha6	UTSW	16	60205732	missense	possibly damaging	0.89
R1593:Epha6	UTSW	16	60424904	missense	probably damaging	1.00
R1764:Epha6	UTSW	16	59775728	missense	probably null	1.00
R1836:Epha6	UTSW	16	60205745	missense	probably damaging	1.00
R2061:Epha6	UTSW	16	59655797	missense	probably damaging	1.00
R2125:Epha6	UTSW	16	59682688	missense	probably damaging	1.00
R2867:Epha6	UTSW	16	59960296	splice site	probably null
R2867:Epha6	UTSW	16	59960296	splice site	probably null
R3760:Epha6	UTSW	16	60220984	missense	possibly damaging	0.70
R4305:Epha6	UTSW	16	60526520	splice site	probably null
R4613:Epha6	UTSW	16	59666597	missense	possibly damaging	0.80
R4818:Epha6	UTSW	16	59654063	missense	probably damaging	0.99
R4832:Epha6	UTSW	16	59960413	missense	probably damaging	0.98
R4895:Epha6	UTSW	16	59666555	missense	probably benign	0.08
R5014:Epha6	UTSW	16	59666579	missense	probably benign	0.00
R5316:Epha6	UTSW	16	59954720	missense	probably damaging	0.99
R5403:Epha6	UTSW	16	59775570	missense	probably damaging	1.00
R5417:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R5418:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R5775:Epha6	UTSW	16	59818994	missense	possibly damaging	0.92
R5808:Epha6	UTSW	16	59682742	missense	probably damaging	1.00
R6076:Epha6	UTSW	16	60205710	missense	probably damaging	1.00
R6146:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6212:Epha6	UTSW	16	60425356	missense	possibly damaging	0.77
R6242:Epha6	UTSW	16	59682662	missense	probably damaging	1.00
R6503:Epha6	UTSW	16	60205621	missense	possibly damaging	0.61
R6580:Epha6	UTSW	16	59682616	missense	probably damaging	1.00
R6726:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6728:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6798:Epha6	UTSW	16	60605064	missense	possibly damaging	0.53
R6798:Epha6	UTSW	16	60605065	missense	possibly damaging	0.53
R6903:Epha6	UTSW	16	60526462	missense	probably benign	0.00
R6999:Epha6	UTSW	16	60425170	missense	possibly damaging	0.94
R7058:Epha6	UTSW	16	59682650	missense	probably damaging	1.00
R7109:Epha6	UTSW	16	59682668	missense	probably damaging	1.00
R7263:Epha6	UTSW	16	59775665	missense	probably damaging	1.00
R7296:Epha6	UTSW	16	59915838	missense	probably benign	0.00
R7343:Epha6	UTSW	16	59960430	missense	probably damaging	0.98
R7443:Epha6	UTSW	16	59775625	missense	possibly damaging	0.93
R7533:Epha6	UTSW	16	60205562	missense	probably damaging	1.00
R7602:Epha6	UTSW	16	59775568	missense	probably damaging	1.00
R7604:Epha6	UTSW	16	60205772	missense	possibly damaging	0.89
R8321:Epha6	UTSW	16	59915954	missense	probably damaging	1.00
R8414:Epha6	UTSW	16	60005667	missense	probably damaging	1.00
R8794:Epha6	UTSW	16	60205672	missense	probably benign	0.00
R8926:Epha6	UTSW	16	59839299	missense	probably benign	0.11
R9166:Epha6	UTSW	16	60604875	missense	probably benign	0.00
R9265:Epha6	UTSW	16	59655754	missense	probably damaging	1.00
R9322:Epha6	UTSW	16	60424755	missense	probably damaging	1.00
Z1188:Epha6	UTSW	16	59654090	missense	probably damaging	1.00
Z1189:Epha6	UTSW	16	59654090	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAATTACCGTCATTCTCCAC -3'
(R):5'- TGTCGGATTCCTTTGTAACTCAG -3'

Sequencing Primer
(F):5'- GTCATTCTCCACAGAAAATTCATGC -3'
(R):5'- CCATGTCCCTTTATGAACTCAAAAAG -3'

Posted On

2016-11-09