Incidental Mutation 'R5678:Zfp119a'
ID442912
Institutional Source Beutler Lab
Gene Symbol Zfp119a
Ensembl Gene ENSMUSG00000057835
Gene Namezinc finger protein 119a
SynonymsMzf13, Zfp119
MMRRC Submission 043317-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5678 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location55864892-55878930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55868336 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 53 (E53G)
Ref Sequence ENSEMBL: ENSMUSP00000078587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079642]
Predicted Effect probably benign
Transcript: ENSMUST00000079642
AA Change: E53G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000078587
Gene: ENSMUSG00000057835
AA Change: E53G

DomainStartEndE-ValueType
KRAB 4 66 6.16e-15 SMART
ZnF_C2H2 155 177 1.57e2 SMART
ZnF_C2H2 261 283 2.14e2 SMART
ZnF_C2H2 289 311 6.78e-3 SMART
ZnF_C2H2 317 339 1.98e-4 SMART
ZnF_C2H2 345 367 4.17e-3 SMART
ZnF_C2H2 373 395 3.39e-3 SMART
ZnF_C2H2 401 423 1.64e-1 SMART
ZnF_C2H2 429 451 5.5e-3 SMART
ZnF_C2H2 457 479 1.51e0 SMART
ZnF_C2H2 485 507 6.32e-3 SMART
ZnF_C2H2 513 535 1.69e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,516,529 T168A probably damaging Het
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
A530016L24Rik T G 12: 112,496,872 C43W probably damaging Het
Aatk T C 11: 120,010,154 T1082A probably benign Het
Acsl1 T A 8: 46,492,850 F7I probably benign Het
Adgb T G 10: 10,431,326 S299R possibly damaging Het
Apob T C 12: 7,991,494 F738L possibly damaging Het
Art3 T C 5: 92,392,550 Y51H probably damaging Het
Atr C T 9: 95,951,487 Q2597* probably null Het
Atrn T C 2: 130,970,016 V627A probably damaging Het
Baz1a T C 12: 54,900,532 K1111E probably damaging Het
Ccdc40 T C 11: 119,231,572 S67P possibly damaging Het
Cd164 T C 10: 41,519,952 probably null Het
Cep295 T C 9: 15,322,858 D2214G probably damaging Het
Clcn1 A G 6: 42,307,265 Y589C probably damaging Het
Col1a2 C T 6: 4,536,239 A998V unknown Het
Csrnp2 T C 15: 100,481,804 *535W probably null Het
Dhrs7 C T 12: 72,657,332 G130D probably damaging Het
Dnah3 T C 7: 120,077,851 T477A probably benign Het
Dscam A G 16: 96,790,900 F725S probably benign Het
Dstyk T C 1: 132,453,291 V508A probably benign Het
Eif4g3 A G 4: 138,151,742 E595G probably damaging Het
Epha6 A T 16: 59,818,979 V844E probably damaging Het
Esrp2 G A 8: 106,132,118 A629V probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
Fndc3b A G 3: 27,429,023 S1009P probably benign Het
Gm13762 A T 2: 88,972,973 L306* probably null Het
Gm14124 A T 2: 150,268,505 R372* probably null Het
Gm8257 A T 14: 44,657,249 I28N probably damaging Het
Ighv5-9-1 T C 12: 113,736,587 E4G possibly damaging Het
Ints3 A G 3: 90,403,548 V455A probably damaging Het
Lamtor2 A G 3: 88,550,794 probably benign Het
Npy1r T C 8: 66,704,203 C92R probably damaging Het
Nup210l T C 3: 90,190,959 V1406A probably damaging Het
Olfr1248 A G 2: 89,617,281 F304L probably benign Het
Olfr978 T C 9: 39,993,903 V31A probably benign Het
Pqlc1 T C 18: 80,257,034 I40T probably damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Qdpr T C 5: 45,447,637 E43G possibly damaging Het
Rps6ka5 T C 12: 100,724,876 E2G unknown Het
Setd2 A G 9: 110,602,186 T5A probably damaging Het
Srpk2 TCA T 5: 23,524,606 probably null Het
Sympk T C 7: 19,049,472 probably null Het
Tchh A T 3: 93,445,626 Q791L unknown Het
Tmed11 T C 5: 108,786,165 D55G probably benign Het
Tnrc18 T C 5: 142,733,564 D1989G unknown Het
Utp20 A T 10: 88,809,117 H582Q probably benign Het
Utrn A G 10: 12,442,018 I554T probably damaging Het
Other mutations in Zfp119a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp119a APN 17 55865792 nonsense probably null
R0421:Zfp119a UTSW 17 55865248 nonsense probably null
R1385:Zfp119a UTSW 17 55865826 missense probably damaging 1.00
R1600:Zfp119a UTSW 17 55868355 missense possibly damaging 0.93
R2310:Zfp119a UTSW 17 55865440 missense probably benign 0.00
R2924:Zfp119a UTSW 17 55868343 missense possibly damaging 0.96
R3910:Zfp119a UTSW 17 55866520 missense probably benign
R4594:Zfp119a UTSW 17 55866325 missense probably benign
R5217:Zfp119a UTSW 17 55865425 nonsense probably null
R5321:Zfp119a UTSW 17 55865595 missense probably damaging 1.00
R5392:Zfp119a UTSW 17 55866328 missense probably benign 0.03
R7033:Zfp119a UTSW 17 55866009 missense probably benign 0.04
R7355:Zfp119a UTSW 17 55866287 nonsense probably null
R7489:Zfp119a UTSW 17 55866158 missense probably damaging 1.00
R8130:Zfp119a UTSW 17 55865971 missense probably damaging 1.00
Z1176:Zfp119a UTSW 17 55866011 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GGACACTTCAATAGCATGGTTCATGA -3'
(R):5'- CCTATGAGGATGTGCATGTGAA -3'

Sequencing Primer
(F):5'- GCATGGTTCATGATTAAATTGTGAC -3'
(R):5'- GCTGGATCCTTCTCAGAAGAGTC -3'
Posted On2016-11-09