Mutagenetix > Incidental Mutation

Incidental Mutation 'R5679:Strc'

442920

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

043176-MU

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Essential gene?

Probably non essential (E-score: 0.205) question?

Stock #

R5679 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121368100 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1437 (S1437P)

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000317] [ENSMUST00000038389] [ENSMUST00000078222] [ENSMUST00000129136]

AlphaFold

Q8VIM6

Predicted Effect

probably benign
Transcript: ENSMUST00000000317

SMART Domains

Protein: ENSMUSP00000000317
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
Pfam:ATP-gua_PtransN	58	133	5.8e-34	PFAM
Pfam:ATP-gua_Ptrans	154	401	4.5e-98	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000038389
AA Change: S1437P

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: S1437P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000078222

SMART Domains

Protein: ENSMUSP00000077349
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
Pfam:ATP-gua_PtransN	55	134	1.2e-37	PFAM
Pfam:ATP-gua_Ptrans	154	401	2e-105	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129136

SMART Domains

Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134443

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150332

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153040

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh3a1	G	A	11: 61,217,168	R346Q	probably benign	Het
Bcat1	A	T	6: 145,007,748	F304L	probably damaging	Het
Ccdc178	T	G	18: 22,067,429	K439N	probably benign	Het
Cdkn2a	T	C	4: 89,276,861	D84G	possibly damaging	Het
Chst8	T	A	7: 34,675,304	H370L	probably damaging	Het
Dimt1	A	G	13: 106,947,600	T32A	possibly damaging	Het
Dph6	T	C	2: 114,567,941	I162V	probably benign	Het
E230025N22Rik	C	T	18: 36,685,382	G465R	possibly damaging	Het
Fbxw7	T	A	3: 84,977,487	N612K	probably damaging	Het
Gpr179	A	G	11: 97,336,745	V1528A	probably benign	Het
Gucy2g	T	A	19: 55,231,079	K370N	possibly damaging	Het
Ipo13	A	T	4: 117,894,832	W903R	probably damaging	Het
Itgax	T	A	7: 128,134,990	H311Q	probably benign	Het
Kmt2d	T	C	15: 98,854,272		probably benign	Het
Lox	T	C	18: 52,528,917	N138S	probably benign	Het
Mre11a	T	A	9: 14,786,919	I21N	probably damaging	Het
Ncan	T	G	8: 70,112,626	Y217S	probably damaging	Het
Nfil3	A	G	13: 52,968,491	F126L	possibly damaging	Het
Nfu1	T	C	6: 87,019,397	V110A	probably damaging	Het
Oit1	T	C	14: 8,349,305	E215G	probably damaging	Het
Olfr1009	A	T	2: 85,722,046	I214F	probably damaging	Het
Olfr1120	T	C	2: 87,357,545	F34L	possibly damaging	Het
Olfr513	A	G	7: 108,754,996	I47V	probably damaging	Het
Palld	T	C	8: 61,684,945	Q592R	possibly damaging	Het
Pcdhac1	T	A	18: 37,092,477	L781Q	probably damaging	Het
Rcl1	A	G	19: 29,121,258		probably null	Het
Saxo1	C	T	4: 86,445,035	V404I	possibly damaging	Het
Scrt1	T	A	15: 76,519,062	T243S	unknown	Het
Slc22a30	G	T	19: 8,335,771	T550K	possibly damaging	Het
Tecpr1	T	A	5: 144,207,423	I654F	possibly damaging	Het
Tfcp2l1	A	G	1: 118,668,647	M371V	probably benign	Het
Vmn2r11	T	C	5: 109,054,842	N123S	probably benign	Het
Wdr81	T	C	11: 75,452,923	D506G	probably damaging	Het
Xylt1	A	G	7: 117,643,650	D640G	probably damaging	Het
Zfp148	T	G	16: 33,495,786	M276R	probably damaging	Het
Zfp329	G	A	7: 12,810,031	T522I	probably damaging	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1650:Strc	UTSW	2	121380885	start gained	probably benign
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121365862	missense	probably benign	0.10
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4578:Strc	UTSW	2	121378003	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121375594	missense	probably benign	0.05
R5480:Strc	UTSW	2	121364819	missense	probably benign	0.00
R5580:Strc	UTSW	2	121375012	missense	probably damaging	0.99
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121374958	missense	probably benign	0.16
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7018:Strc	UTSW	2	121369058	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7758:Strc	UTSW	2	121370946	missense	probably benign
R7822:Strc	UTSW	2	121377738	missense	probably benign	0.01
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121377363	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
R8792:Strc	UTSW	2	121377805	missense	probably damaging	0.99
R8874:Strc	UTSW	2	121374872	critical splice donor site	probably null
R8947:Strc	UTSW	2	121370989	missense	probably benign	0.09
R9285:Strc	UTSW	2	121364798	missense	probably damaging	1.00
R9302:Strc	UTSW	2	121380855	missense	unknown
R9386:Strc	UTSW	2	121367730	missense	probably damaging	0.99
R9438:Strc	UTSW	2	121368166	missense	probably damaging	1.00
R9581:Strc	UTSW	2	121377447	missense	probably damaging	0.99
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTGCTATCATTTCCAGATCC -3'
(R):5'- ATGCCTAAAGGTACCCTGGC -3'

Sequencing Primer
(F):5'- GCCTGGGCTATAGAATGAATCACTC -3'
(R):5'- TAAAGGTACCCTGGCTCCCC -3'

Posted On

2016-11-09