Incidental Mutation 'R5679:Strc'
ID442920
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Namestereocilin
SynonymsDFNB16
MMRRC Submission 043176-MU
Accession Numbers

Genbank: NM_080459; MGI: 2153816

Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R5679 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121363728-121387168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121368100 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1437 (S1437P)
Ref Sequence ENSEMBL: ENSMUSP00000039378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000317] [ENSMUST00000038389] [ENSMUST00000078222] [ENSMUST00000129136]
Predicted Effect probably benign
Transcript: ENSMUST00000000317
SMART Domains Protein: ENSMUSP00000000317
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 58 133 5.8e-34 PFAM
Pfam:ATP-gua_Ptrans 154 401 4.5e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038389
AA Change: S1437P

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: S1437P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078222
SMART Domains Protein: ENSMUSP00000077349
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 1.2e-37 PFAM
Pfam:ATP-gua_Ptrans 154 401 2e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129136
SMART Domains Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153040
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 G A 11: 61,217,168 R346Q probably benign Het
Bcat1 A T 6: 145,007,748 F304L probably damaging Het
Ccdc178 T G 18: 22,067,429 K439N probably benign Het
Cdkn2a T C 4: 89,276,861 D84G possibly damaging Het
Chst8 T A 7: 34,675,304 H370L probably damaging Het
Dimt1 A G 13: 106,947,600 T32A possibly damaging Het
Dph6 T C 2: 114,567,941 I162V probably benign Het
E230025N22Rik C T 18: 36,685,382 G465R possibly damaging Het
Fbxw7 T A 3: 84,977,487 N612K probably damaging Het
Gpr179 A G 11: 97,336,745 V1528A probably benign Het
Gucy2g T A 19: 55,231,079 K370N possibly damaging Het
Ipo13 A T 4: 117,894,832 W903R probably damaging Het
Itgax T A 7: 128,134,990 H311Q probably benign Het
Kmt2d T C 15: 98,854,272 probably benign Het
Lox T C 18: 52,528,917 N138S probably benign Het
Mre11a T A 9: 14,786,919 I21N probably damaging Het
Ncan T G 8: 70,112,626 Y217S probably damaging Het
Nfil3 A G 13: 52,968,491 F126L possibly damaging Het
Nfu1 T C 6: 87,019,397 V110A probably damaging Het
Oit1 T C 14: 8,349,305 E215G probably damaging Het
Olfr1009 A T 2: 85,722,046 I214F probably damaging Het
Olfr1120 T C 2: 87,357,545 F34L possibly damaging Het
Olfr513 A G 7: 108,754,996 I47V probably damaging Het
Palld T C 8: 61,684,945 Q592R possibly damaging Het
Pcdhac1 T A 18: 37,092,477 L781Q probably damaging Het
Rcl1 A G 19: 29,121,258 probably null Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Scrt1 T A 15: 76,519,062 T243S unknown Het
Slc22a30 G T 19: 8,335,771 T550K possibly damaging Het
Tecpr1 T A 5: 144,207,423 I654F possibly damaging Het
Tfcp2l1 A G 1: 118,668,647 M371V probably benign Het
Vmn2r11 T C 5: 109,054,842 N123S probably benign Het
Wdr81 T C 11: 75,452,923 D506G probably damaging Het
Xylt1 A G 7: 117,643,650 D640G probably damaging Het
Zfp148 T G 16: 33,495,786 M276R probably damaging Het
Zfp329 G A 7: 12,810,031 T522I probably damaging Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121365060 missense probably benign 0.39
IGL01152:Strc APN 2 121370795 missense probably benign
IGL01608:Strc APN 2 121375594 missense probably benign 0.05
IGL01695:Strc APN 2 121375298 missense probably damaging 1.00
IGL01715:Strc APN 2 121365737 splice site probably null
IGL01906:Strc APN 2 121377634 missense probably benign
IGL02135:Strc APN 2 121364834 missense probably damaging 1.00
IGL02416:Strc APN 2 121369058 missense probably damaging 1.00
IGL02455:Strc APN 2 121375791 unclassified probably benign
IGL03029:Strc APN 2 121364044 missense possibly damaging 0.95
IGL03176:Strc APN 2 121372180 missense probably damaging 0.99
IGL03272:Strc APN 2 121371751 missense probably damaging 1.00
3-1:Strc UTSW 2 121373680 missense probably damaging 0.99
IGL02799:Strc UTSW 2 121379236 missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121375307 missense probably damaging 1.00
R0022:Strc UTSW 2 121368393 missense probably damaging 1.00
R0494:Strc UTSW 2 121379533 missense probably damaging 0.99
R1065:Strc UTSW 2 121366651 missense probably damaging 1.00
R1148:Strc UTSW 2 121372077 intron probably benign
R1148:Strc UTSW 2 121372077 intron probably benign
R1203:Strc UTSW 2 121372123 missense possibly damaging 0.66
R1343:Strc UTSW 2 121365115 missense probably benign 0.21
R1544:Strc UTSW 2 121372738 splice site probably null
R1650:Strc UTSW 2 121380885 start gained probably benign
R1840:Strc UTSW 2 121379296 missense probably damaging 1.00
R1983:Strc UTSW 2 121371037 missense possibly damaging 0.54
R2035:Strc UTSW 2 121374934 missense probably damaging 1.00
R2058:Strc UTSW 2 121378887 missense probably damaging 1.00
R2158:Strc UTSW 2 121365862 missense probably benign 0.10
R2219:Strc UTSW 2 121364523 missense probably damaging 1.00
R2680:Strc UTSW 2 121365111 missense probably damaging 0.99
R4375:Strc UTSW 2 121380823 missense unknown
R4563:Strc UTSW 2 121365805 missense probably benign 0.02
R4578:Strc UTSW 2 121378003 missense possibly damaging 0.94
R4607:Strc UTSW 2 121372945 missense probably benign 0.31
R4651:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4652:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4790:Strc UTSW 2 121375594 missense probably benign 0.05
R5480:Strc UTSW 2 121364819 missense probably benign 0.00
R5580:Strc UTSW 2 121375012 missense probably damaging 0.99
R5703:Strc UTSW 2 121370814 missense probably benign
R5841:Strc UTSW 2 121365877 missense probably benign 0.29
R5917:Strc UTSW 2 121379309 missense probably benign
R5958:Strc UTSW 2 121376922 missense possibly damaging 0.56
R6320:Strc UTSW 2 121374958 missense probably benign 0.16
R6619:Strc UTSW 2 121368432 missense probably damaging 0.99
R6695:Strc UTSW 2 121377224 missense probably benign 0.35
R6970:Strc UTSW 2 121378014 missense probably benign 0.41
R7018:Strc UTSW 2 121369058 missense probably damaging 1.00
R7045:Strc UTSW 2 121370726 missense probably damaging 1.00
R7190:Strc UTSW 2 121369026 missense probably benign 0.14
R7283:Strc UTSW 2 121379452 missense probably damaging 0.99
R7694:Strc UTSW 2 121377096 missense probably damaging 1.00
R7699:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7700:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7756:Strc UTSW 2 121370946 missense probably benign
R7758:Strc UTSW 2 121370946 missense probably benign
R7822:Strc UTSW 2 121377738 missense probably benign 0.01
R7830:Strc UTSW 2 121375049 missense probably damaging 0.99
R7953:Strc UTSW 2 121377363 missense probably damaging 0.99
R8137:Strc UTSW 2 121366738 missense probably damaging 0.98
R8394:Strc UTSW 2 121379009 missense probably benign 0.00
R8427:Strc UTSW 2 121377531 missense probably damaging 1.00
Z1176:Strc UTSW 2 121375521 missense probably damaging 0.98
Z1176:Strc UTSW 2 121379044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGCTATCATTTCCAGATCC -3'
(R):5'- ATGCCTAAAGGTACCCTGGC -3'

Sequencing Primer
(F):5'- GCCTGGGCTATAGAATGAATCACTC -3'
(R):5'- TAAAGGTACCCTGGCTCCCC -3'
Posted On2016-11-09