Mutagenetix > Incidental Mutation

Incidental Mutation 'R5679:Strc'

442920

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

043176-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.235) question?

Stock #

R5679 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121193729-121211851 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121198581 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1437 (S1437P)

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000317] [ENSMUST00000038389] [ENSMUST00000078222] [ENSMUST00000129136]

AlphaFold

Q8VIM6

Predicted Effect

probably benign
Transcript: ENSMUST00000000317

SMART Domains

Protein: ENSMUSP00000000317
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
Pfam:ATP-gua_PtransN	58	133	5.8e-34	PFAM
Pfam:ATP-gua_Ptrans	154	401	4.5e-98	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000038389
AA Change: S1437P

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: S1437P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000078222

SMART Domains

Protein: ENSMUSP00000077349
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
Pfam:ATP-gua_PtransN	55	134	1.2e-37	PFAM
Pfam:ATP-gua_Ptrans	154	401	2e-105	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129136

SMART Domains

Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134443

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150332

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153040

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh3a1	G	A	11: 61,107,994 (GRCm39)	R346Q	probably benign	Het
Bcat1	A	T	6: 144,953,474 (GRCm39)	F304L	probably damaging	Het
Ccdc178	T	G	18: 22,200,486 (GRCm39)	K439N	probably benign	Het
Cdkn2a	T	C	4: 89,195,098 (GRCm39)	D84G	possibly damaging	Het
Chst8	T	A	7: 34,374,729 (GRCm39)	H370L	probably damaging	Het
Dimt1	A	G	13: 107,084,108 (GRCm39)	T32A	possibly damaging	Het
Dph6	T	C	2: 114,398,422 (GRCm39)	I162V	probably benign	Het
E230025N22Rik	C	T	18: 36,818,435 (GRCm39)	G465R	possibly damaging	Het
Fam3d	T	C	14: 8,349,305 (GRCm38)	E215G	probably damaging	Het
Fbxw7	T	A	3: 84,884,794 (GRCm39)	N612K	probably damaging	Het
Gpr179	A	G	11: 97,227,571 (GRCm39)	V1528A	probably benign	Het
Gucy2g	T	A	19: 55,219,511 (GRCm39)	K370N	possibly damaging	Het
Ipo13	A	T	4: 117,752,029 (GRCm39)	W903R	probably damaging	Het
Itgax	T	A	7: 127,734,162 (GRCm39)	H311Q	probably benign	Het
Kmt2d	T	C	15: 98,752,153 (GRCm39)		probably benign	Het
Lox	T	C	18: 52,661,989 (GRCm39)	N138S	probably benign	Het
Mre11a	T	A	9: 14,698,215 (GRCm39)	I21N	probably damaging	Het
Ncan	T	G	8: 70,565,276 (GRCm39)	Y217S	probably damaging	Het
Nfil3	A	G	13: 53,122,527 (GRCm39)	F126L	possibly damaging	Het
Nfu1	T	C	6: 86,996,379 (GRCm39)	V110A	probably damaging	Het
Or12e8	T	C	2: 87,187,889 (GRCm39)	F34L	possibly damaging	Het
Or5e1	A	G	7: 108,354,203 (GRCm39)	I47V	probably damaging	Het
Or5g9	A	T	2: 85,552,390 (GRCm39)	I214F	probably damaging	Het
Palld	T	C	8: 62,137,979 (GRCm39)	Q592R	possibly damaging	Het
Pcdhac1	T	A	18: 37,225,530 (GRCm39)	L781Q	probably damaging	Het
Rcl1	A	G	19: 29,098,658 (GRCm39)		probably null	Het
Saxo1	C	T	4: 86,363,272 (GRCm39)	V404I	possibly damaging	Het
Scrt1	T	A	15: 76,403,262 (GRCm39)	T243S	unknown	Het
Slc22a30	G	T	19: 8,313,135 (GRCm39)	T550K	possibly damaging	Het
Tecpr1	T	A	5: 144,144,241 (GRCm39)	I654F	possibly damaging	Het
Tfcp2l1	A	G	1: 118,596,377 (GRCm39)	M371V	probably benign	Het
Vmn2r11	T	C	5: 109,202,708 (GRCm39)	N123S	probably benign	Het
Wdr81	T	C	11: 75,343,749 (GRCm39)	D506G	probably damaging	Het
Xylt1	A	G	7: 117,242,877 (GRCm39)	D640G	probably damaging	Het
Zfp148	T	G	16: 33,316,156 (GRCm39)	M276R	probably damaging	Het
Zfp329	G	A	7: 12,543,958 (GRCm39)	T522I	probably damaging	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121,195,541 (GRCm39)	missense	probably benign	0.39
IGL01152:Strc	APN	2	121,201,276 (GRCm39)	missense	probably benign
IGL01608:Strc	APN	2	121,206,075 (GRCm39)	missense	probably benign	0.05
IGL01695:Strc	APN	2	121,205,779 (GRCm39)	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121,196,218 (GRCm39)	splice site	probably null
IGL01906:Strc	APN	2	121,208,115 (GRCm39)	missense	probably benign
IGL02135:Strc	APN	2	121,195,315 (GRCm39)	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121,199,539 (GRCm39)	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121,206,272 (GRCm39)	unclassified	probably benign
IGL03029:Strc	APN	2	121,194,525 (GRCm39)	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121,202,661 (GRCm39)	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121,202,232 (GRCm39)	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121,204,161 (GRCm39)	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121,209,717 (GRCm39)	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121,205,788 (GRCm39)	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121,198,874 (GRCm39)	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121,210,014 (GRCm39)	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121,197,132 (GRCm39)	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121,202,558 (GRCm39)	intron	probably benign
R1148:Strc	UTSW	2	121,202,558 (GRCm39)	intron	probably benign
R1203:Strc	UTSW	2	121,202,604 (GRCm39)	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121,195,596 (GRCm39)	missense	probably benign	0.21
R1544:Strc	UTSW	2	121,203,219 (GRCm39)	splice site	probably null
R1650:Strc	UTSW	2	121,211,366 (GRCm39)	start gained	probably benign
R1840:Strc	UTSW	2	121,209,777 (GRCm39)	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121,201,518 (GRCm39)	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121,205,415 (GRCm39)	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121,209,368 (GRCm39)	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121,196,343 (GRCm39)	missense	probably benign	0.10
R2219:Strc	UTSW	2	121,195,004 (GRCm39)	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121,195,592 (GRCm39)	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121,211,304 (GRCm39)	missense	unknown
R4563:Strc	UTSW	2	121,196,286 (GRCm39)	missense	probably benign	0.02
R4578:Strc	UTSW	2	121,208,484 (GRCm39)	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121,203,426 (GRCm39)	missense	probably benign	0.31
R4651:Strc	UTSW	2	121,204,829 (GRCm39)	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121,204,829 (GRCm39)	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121,206,075 (GRCm39)	missense	probably benign	0.05
R5480:Strc	UTSW	2	121,195,300 (GRCm39)	missense	probably benign	0.00
R5580:Strc	UTSW	2	121,205,493 (GRCm39)	missense	probably damaging	0.99
R5703:Strc	UTSW	2	121,201,295 (GRCm39)	missense	probably benign
R5841:Strc	UTSW	2	121,196,358 (GRCm39)	missense	probably benign	0.29
R5917:Strc	UTSW	2	121,209,790 (GRCm39)	missense	probably benign
R5958:Strc	UTSW	2	121,207,403 (GRCm39)	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121,205,439 (GRCm39)	missense	probably benign	0.16
R6619:Strc	UTSW	2	121,198,913 (GRCm39)	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121,207,705 (GRCm39)	missense	probably benign	0.35
R6970:Strc	UTSW	2	121,208,495 (GRCm39)	missense	probably benign	0.41
R7018:Strc	UTSW	2	121,199,539 (GRCm39)	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121,201,207 (GRCm39)	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121,199,507 (GRCm39)	missense	probably benign	0.14
R7283:Strc	UTSW	2	121,209,933 (GRCm39)	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121,207,577 (GRCm39)	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121,202,229 (GRCm39)	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121,202,229 (GRCm39)	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121,201,427 (GRCm39)	missense	probably benign
R7758:Strc	UTSW	2	121,201,427 (GRCm39)	missense	probably benign
R7822:Strc	UTSW	2	121,208,219 (GRCm39)	missense	probably benign	0.01
R7830:Strc	UTSW	2	121,205,530 (GRCm39)	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121,207,844 (GRCm39)	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121,197,219 (GRCm39)	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121,209,490 (GRCm39)	missense	probably benign	0.00
R8427:Strc	UTSW	2	121,208,012 (GRCm39)	missense	probably damaging	1.00
R8792:Strc	UTSW	2	121,208,286 (GRCm39)	missense	probably damaging	0.99
R8874:Strc	UTSW	2	121,205,353 (GRCm39)	critical splice donor site	probably null
R8947:Strc	UTSW	2	121,201,470 (GRCm39)	missense	probably benign	0.09
R9285:Strc	UTSW	2	121,195,279 (GRCm39)	missense	probably damaging	1.00
R9302:Strc	UTSW	2	121,211,336 (GRCm39)	missense	unknown
R9386:Strc	UTSW	2	121,198,211 (GRCm39)	missense	probably damaging	0.99
R9438:Strc	UTSW	2	121,198,647 (GRCm39)	missense	probably damaging	1.00
R9581:Strc	UTSW	2	121,207,928 (GRCm39)	missense	probably damaging	0.99
Z1176:Strc	UTSW	2	121,209,525 (GRCm39)	missense	probably damaging	1.00
Z1176:Strc	UTSW	2	121,206,002 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGTGCTATCATTTCCAGATCC -3'
(R):5'- ATGCCTAAAGGTACCCTGGC -3'

Sequencing Primer
(F):5'- GCCTGGGCTATAGAATGAATCACTC -3'
(R):5'- TAAAGGTACCCTGGCTCCCC -3'

Posted On

2016-11-09