Incidental Mutation 'R5679:Bcat1'
ID 442930
Institutional Source Beutler Lab
Gene Symbol Bcat1
Ensembl Gene ENSMUSG00000030268
Gene Name branched chain aminotransferase 1, cytosolic
Synonyms Eca39, BCATc, Bcat-1
MMRRC Submission 043176-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R5679 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 144939561-145021883 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 144953474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 304 (F304L)
Ref Sequence ENSEMBL: ENSMUSP00000039744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032402] [ENSMUST00000048252] [ENSMUST00000111742] [ENSMUST00000204138]
AlphaFold P24288
Predicted Effect probably damaging
Transcript: ENSMUST00000032402
AA Change: F371L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032402
Gene: ENSMUSG00000030268
AA Change: F371L

DomainStartEndE-ValueType
Pfam:Aminotran_4 160 410 1.3e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000048252
AA Change: F304L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039744
Gene: ENSMUSG00000030268
AA Change: F304L

DomainStartEndE-ValueType
Pfam:Aminotran_4 111 354 5.9e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111742
AA Change: F304L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107371
Gene: ENSMUSG00000030268
AA Change: F304L

DomainStartEndE-ValueType
Pfam:Aminotran_4 111 354 1.7e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145911
Predicted Effect probably benign
Transcript: ENSMUST00000204138
AA Change: F174L

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144968
Gene: ENSMUSG00000030268
AA Change: F174L

DomainStartEndE-ValueType
Pfam:Aminotran_4 34 180 9.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of the enzyme branched-chain amino acid transaminase. This enzyme catalyzes the reversible transamination of branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth. Two different clinical disorders have been attributed to a defect of branched-chain amino acid transamination: hypervalinemia and hyperleucine-isoleucinemia. As there is also a gene encoding a mitochondrial form of this enzyme, mutations in either gene may contribute to these disorders. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null mutation display abnormal amino acid metabilism in T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 G A 11: 61,107,994 (GRCm39) R346Q probably benign Het
Ccdc178 T G 18: 22,200,486 (GRCm39) K439N probably benign Het
Cdkn2a T C 4: 89,195,098 (GRCm39) D84G possibly damaging Het
Chst8 T A 7: 34,374,729 (GRCm39) H370L probably damaging Het
Dimt1 A G 13: 107,084,108 (GRCm39) T32A possibly damaging Het
Dph6 T C 2: 114,398,422 (GRCm39) I162V probably benign Het
E230025N22Rik C T 18: 36,818,435 (GRCm39) G465R possibly damaging Het
Fam3d T C 14: 8,349,305 (GRCm38) E215G probably damaging Het
Fbxw7 T A 3: 84,884,794 (GRCm39) N612K probably damaging Het
Gpr179 A G 11: 97,227,571 (GRCm39) V1528A probably benign Het
Gucy2g T A 19: 55,219,511 (GRCm39) K370N possibly damaging Het
Ipo13 A T 4: 117,752,029 (GRCm39) W903R probably damaging Het
Itgax T A 7: 127,734,162 (GRCm39) H311Q probably benign Het
Kmt2d T C 15: 98,752,153 (GRCm39) probably benign Het
Lox T C 18: 52,661,989 (GRCm39) N138S probably benign Het
Mre11a T A 9: 14,698,215 (GRCm39) I21N probably damaging Het
Ncan T G 8: 70,565,276 (GRCm39) Y217S probably damaging Het
Nfil3 A G 13: 53,122,527 (GRCm39) F126L possibly damaging Het
Nfu1 T C 6: 86,996,379 (GRCm39) V110A probably damaging Het
Or12e8 T C 2: 87,187,889 (GRCm39) F34L possibly damaging Het
Or5e1 A G 7: 108,354,203 (GRCm39) I47V probably damaging Het
Or5g9 A T 2: 85,552,390 (GRCm39) I214F probably damaging Het
Palld T C 8: 62,137,979 (GRCm39) Q592R possibly damaging Het
Pcdhac1 T A 18: 37,225,530 (GRCm39) L781Q probably damaging Het
Rcl1 A G 19: 29,098,658 (GRCm39) probably null Het
Saxo1 C T 4: 86,363,272 (GRCm39) V404I possibly damaging Het
Scrt1 T A 15: 76,403,262 (GRCm39) T243S unknown Het
Slc22a30 G T 19: 8,313,135 (GRCm39) T550K possibly damaging Het
Strc A G 2: 121,198,581 (GRCm39) S1437P probably benign Het
Tecpr1 T A 5: 144,144,241 (GRCm39) I654F possibly damaging Het
Tfcp2l1 A G 1: 118,596,377 (GRCm39) M371V probably benign Het
Vmn2r11 T C 5: 109,202,708 (GRCm39) N123S probably benign Het
Wdr81 T C 11: 75,343,749 (GRCm39) D506G probably damaging Het
Xylt1 A G 7: 117,242,877 (GRCm39) D640G probably damaging Het
Zfp148 T G 16: 33,316,156 (GRCm39) M276R probably damaging Het
Zfp329 G A 7: 12,543,958 (GRCm39) T522I probably damaging Het
Other mutations in Bcat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Bcat1 APN 6 144,946,015 (GRCm39) missense possibly damaging 0.89
IGL01882:Bcat1 APN 6 144,950,135 (GRCm39) missense probably damaging 1.00
IGL02021:Bcat1 APN 6 144,993,015 (GRCm39) splice site probably benign
IGL02024:Bcat1 APN 6 144,978,564 (GRCm39) missense probably damaging 0.97
IGL02705:Bcat1 APN 6 144,964,914 (GRCm39) splice site probably benign
IGL02954:Bcat1 APN 6 144,964,945 (GRCm39) missense probably damaging 1.00
R0331:Bcat1 UTSW 6 144,993,040 (GRCm39) missense probably benign 0.17
R1592:Bcat1 UTSW 6 144,955,784 (GRCm39) missense probably benign 0.00
R1680:Bcat1 UTSW 6 144,985,354 (GRCm39) missense probably damaging 1.00
R2162:Bcat1 UTSW 6 144,955,834 (GRCm39) missense probably damaging 1.00
R2306:Bcat1 UTSW 6 144,953,379 (GRCm39) missense probably damaging 0.96
R3498:Bcat1 UTSW 6 144,965,068 (GRCm39) missense probably damaging 0.99
R3758:Bcat1 UTSW 6 144,978,598 (GRCm39) missense probably damaging 1.00
R3831:Bcat1 UTSW 6 144,955,834 (GRCm39) missense probably damaging 1.00
R3833:Bcat1 UTSW 6 144,955,834 (GRCm39) missense probably damaging 1.00
R4829:Bcat1 UTSW 6 144,961,201 (GRCm39) missense probably damaging 1.00
R5250:Bcat1 UTSW 6 144,993,165 (GRCm39) critical splice donor site probably null
R5338:Bcat1 UTSW 6 144,953,353 (GRCm39) missense possibly damaging 0.50
R5414:Bcat1 UTSW 6 144,961,173 (GRCm39) critical splice donor site probably null
R6566:Bcat1 UTSW 6 144,961,210 (GRCm39) missense probably damaging 1.00
R7015:Bcat1 UTSW 6 144,985,309 (GRCm39) missense probably damaging 0.99
R7255:Bcat1 UTSW 6 144,978,511 (GRCm39) nonsense probably null
R7606:Bcat1 UTSW 6 144,994,358 (GRCm39) missense probably benign 0.06
R8115:Bcat1 UTSW 6 144,955,819 (GRCm39) missense probably damaging 1.00
R9198:Bcat1 UTSW 6 144,985,222 (GRCm39) missense probably damaging 1.00
R9342:Bcat1 UTSW 6 144,994,332 (GRCm39) missense probably benign
R9588:Bcat1 UTSW 6 144,950,126 (GRCm39) missense probably benign 0.04
R9665:Bcat1 UTSW 6 144,994,488 (GRCm39) missense probably benign
RF004:Bcat1 UTSW 6 144,953,349 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTTGAGCCAACCCAGGAC -3'
(R):5'- TGACACCATCCAAGTTCAGC -3'

Sequencing Primer
(F):5'- GTTCTCAGCCTGGATGATAAACGTC -3'
(R):5'- ATCCAAGTTCAGCCAGATCC -3'
Posted On 2016-11-09