Mutagenetix > Incidental Mutation

Incidental Mutation 'R5679:Palld'

442936

Institutional Source

Beutler Lab

Gene Symbol

Palld

Ensembl Gene

ENSMUSG00000058056

Gene Name

palladin, cytoskeletal associated protein

Synonyms

2410003B16Rik

MMRRC Submission

043176-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5679 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

61511433-61902690 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 61684945 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 592 (Q592R)

Ref Sequence

ENSEMBL: ENSMUSP00000112442 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034057] [ENSMUST00000121493] [ENSMUST00000121785]

AlphaFold

Q9ET54

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034057
AA Change: Q592R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000034057
Gene: ENSMUSG00000058056
AA Change: Q592R

Domain	Start	End	E-Value	Type
IGc2	290	358	1.45e-9	SMART
low complexity region	372	385	N/A	INTRINSIC
IGc2	460	535	1.6e-11	SMART
low complexity region	639	667	N/A	INTRINSIC
IGc2	796	865	3.1e-9	SMART
low complexity region	881	906	N/A	INTRINSIC
IGc2	930	998	4.92e-12	SMART
IGc2	1029	1098	1.61e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000121493
AA Change: Q203R

SMART Domains

Protein: ENSMUSP00000113874
Gene: ENSMUSG00000058056
AA Change: Q203R

Domain	Start	End	E-Value	Type
IGc2	71	146	1.6e-11	SMART
low complexity region	250	284	N/A	INTRINSIC
low complexity region	298	326	N/A	INTRINSIC
low complexity region	376	407	N/A	INTRINSIC
low complexity region	416	451	N/A	INTRINSIC
IGc2	632	701	3.1e-9	SMART
low complexity region	717	742	N/A	INTRINSIC
IGc2	766	834	4.92e-12	SMART
IGc2	865	934	1.61e-7	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121785
AA Change: Q592R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000112442
Gene: ENSMUSG00000058056
AA Change: Q592R

Domain	Start	End	E-Value	Type
IGc2	290	358	1.45e-9	SMART
low complexity region	372	385	N/A	INTRINSIC
IGc2	460	535	1.6e-11	SMART
low complexity region	639	673	N/A	INTRINSIC
low complexity region	687	715	N/A	INTRINSIC
low complexity region	765	796	N/A	INTRINSIC
low complexity region	805	840	N/A	INTRINSIC
IGc2	1038	1107	3.1e-9	SMART
low complexity region	1123	1148	N/A	INTRINSIC
IGc2	1172	1240	4.92e-12	SMART
IGc2	1271	1340	1.61e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149042

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is required for organizing the actin cytoskeleton. The protein is a component of actin-containing microfilaments, and it is involved in the control of cell shape, adhesion, and contraction. Polymorphisms in this gene are associated with a susceptibility to pancreatic cancer type 1, and also with a risk for myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: All homozygous null embryos die around E15.5 displaying exencephaly derived from neural tube closure defects, and herniation of the intestine and liver due to ventral closure defects. Mutant MEFs show impaired formation of actin stress fibers, reduced migration and decreased adhesion to fibronectin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh3a1	G	A	11: 61,217,168	R346Q	probably benign	Het
Bcat1	A	T	6: 145,007,748	F304L	probably damaging	Het
Ccdc178	T	G	18: 22,067,429	K439N	probably benign	Het
Cdkn2a	T	C	4: 89,276,861	D84G	possibly damaging	Het
Chst8	T	A	7: 34,675,304	H370L	probably damaging	Het
Dimt1	A	G	13: 106,947,600	T32A	possibly damaging	Het
Dph6	T	C	2: 114,567,941	I162V	probably benign	Het
E230025N22Rik	C	T	18: 36,685,382	G465R	possibly damaging	Het
Fbxw7	T	A	3: 84,977,487	N612K	probably damaging	Het
Gpr179	A	G	11: 97,336,745	V1528A	probably benign	Het
Gucy2g	T	A	19: 55,231,079	K370N	possibly damaging	Het
Ipo13	A	T	4: 117,894,832	W903R	probably damaging	Het
Itgax	T	A	7: 128,134,990	H311Q	probably benign	Het
Kmt2d	T	C	15: 98,854,272		probably benign	Het
Lox	T	C	18: 52,528,917	N138S	probably benign	Het
Mre11a	T	A	9: 14,786,919	I21N	probably damaging	Het
Ncan	T	G	8: 70,112,626	Y217S	probably damaging	Het
Nfil3	A	G	13: 52,968,491	F126L	possibly damaging	Het
Nfu1	T	C	6: 87,019,397	V110A	probably damaging	Het
Oit1	T	C	14: 8,349,305	E215G	probably damaging	Het
Olfr1009	A	T	2: 85,722,046	I214F	probably damaging	Het
Olfr1120	T	C	2: 87,357,545	F34L	possibly damaging	Het
Olfr513	A	G	7: 108,754,996	I47V	probably damaging	Het
Pcdhac1	T	A	18: 37,092,477	L781Q	probably damaging	Het
Rcl1	A	G	19: 29,121,258		probably null	Het
Saxo1	C	T	4: 86,445,035	V404I	possibly damaging	Het
Scrt1	T	A	15: 76,519,062	T243S	unknown	Het
Slc22a30	G	T	19: 8,335,771	T550K	possibly damaging	Het
Strc	A	G	2: 121,368,100	S1437P	probably benign	Het
Tecpr1	T	A	5: 144,207,423	I654F	possibly damaging	Het
Tfcp2l1	A	G	1: 118,668,647	M371V	probably benign	Het
Vmn2r11	T	C	5: 109,054,842	N123S	probably benign	Het
Wdr81	T	C	11: 75,452,923	D506G	probably damaging	Het
Xylt1	A	G	7: 117,643,650	D640G	probably damaging	Het
Zfp148	T	G	16: 33,495,786	M276R	probably damaging	Het
Zfp329	G	A	7: 12,810,031	T522I	probably damaging	Het

Other mutations in Palld

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00917:Palld	APN	8	61515935	missense	possibly damaging	0.77
IGL01083:Palld	APN	8	61538807	missense	probably benign	0.44
IGL01644:Palld	APN	8	61877478	missense	probably benign	0.28
IGL01672:Palld	APN	8	61877502	missense	probably benign	0.22
IGL01941:Palld	APN	8	61535700	missense	probably benign	0.44
IGL02037:Palld	APN	8	61525114	missense	probably damaging	1.00
IGL02126:Palld	APN	8	61877442	missense	possibly damaging	0.82
IGL02537:Palld	APN	8	61684934	missense	probably benign	0.05
IGL02632:Palld	APN	8	61515245	missense	probably damaging	1.00
IGL02809:Palld	APN	8	61515247	missense	probably damaging	1.00
IGL02901:Palld	APN	8	61876995	nonsense	probably null
IGL03400:Palld	APN	8	61513455	missense	probably damaging	1.00
R0098:Palld	UTSW	8	61525086	missense	probably damaging	1.00
R0098:Palld	UTSW	8	61525086	missense	probably damaging	1.00
R0745:Palld	UTSW	8	61877703	missense	probably damaging	1.00
R1263:Palld	UTSW	8	61513457	frame shift	probably null
R1342:Palld	UTSW	8	61522882	critical splice donor site	probably null
R1893:Palld	UTSW	8	61516621	missense	probably damaging	1.00
R2017:Palld	UTSW	8	61684765	missense	probably damaging	0.99
R2102:Palld	UTSW	8	61533433	missense	possibly damaging	0.82
R2129:Palld	UTSW	8	61877361	missense	probably benign	0.00
R2246:Palld	UTSW	8	61877135	missense	probably benign	0.01
R3545:Palld	UTSW	8	61550078	missense	possibly damaging	0.95
R3815:Palld	UTSW	8	61549837	intron	probably benign
R3824:Palld	UTSW	8	61709033	missense	probably damaging	1.00
R4412:Palld	UTSW	8	61687372	missense	probably damaging	0.98
R4781:Palld	UTSW	8	61877028	missense	probably benign	0.01
R4836:Palld	UTSW	8	61687381	missense	probably benign	0.11
R4871:Palld	UTSW	8	61549781	intron	probably benign
R4963:Palld	UTSW	8	61703210	missense	probably damaging	1.00
R5036:Palld	UTSW	8	61550162	missense	probably damaging	1.00
R5128:Palld	UTSW	8	61720588	missense	probably damaging	1.00
R5343:Palld	UTSW	8	61549815	intron	probably benign
R5421:Palld	UTSW	8	61516550	missense	probably damaging	1.00
R5427:Palld	UTSW	8	61550072	missense	probably benign	0.01
R5561:Palld	UTSW	8	61516585	missense	probably damaging	1.00
R5651:Palld	UTSW	8	61538788	missense	probably damaging	1.00
R5915:Palld	UTSW	8	61533352	critical splice donor site	probably null
R6153:Palld	UTSW	8	61550152	missense	probably damaging	1.00
R6276:Palld	UTSW	8	61513423	missense	probably damaging	1.00
R6323:Palld	UTSW	8	61720693	missense	probably damaging	1.00
R6659:Palld	UTSW	8	61533443	missense	probably benign	0.28
R7016:Palld	UTSW	8	61515998	missense	probably damaging	1.00
R7124:Palld	UTSW	8	61516645	missense	unknown
R7145:Palld	UTSW	8	61532017	missense	unknown
R7386:Palld	UTSW	8	61532052	missense	unknown
R7407:Palld	UTSW	8	61515941	nonsense	probably null
R7723:Palld	UTSW	8	61711458	missense	probably damaging	1.00
R8029:Palld	UTSW	8	61877312	missense	probably damaging	1.00
R8402:Palld	UTSW	8	61711406	missense	probably damaging	1.00
R8775:Palld	UTSW	8	61684972	missense	possibly damaging	0.73
R8775-TAIL:Palld	UTSW	8	61684972	missense	possibly damaging	0.73
R8887:Palld	UTSW	8	61533478	missense	unknown
R8906:Palld	UTSW	8	61550164	critical splice donor site	probably null
R8969:Palld	UTSW	8	61684849	missense	probably damaging	1.00
R8971:Palld	UTSW	8	61516701	missense	unknown
R8990:Palld	UTSW	8	61515245	missense	probably damaging	1.00
R9012:Palld	UTSW	8	61720663	missense	possibly damaging	0.85
R9145:Palld	UTSW	8	61877073	missense	probably benign	0.01
R9221:Palld	UTSW	8	61516557	missense	unknown
R9228:Palld	UTSW	8	61720537	missense	probably damaging	1.00
R9311:Palld	UTSW	8	61525155	missense	unknown
R9355:Palld	UTSW	8	61516657	missense	unknown
R9376:Palld	UTSW	8	61516657	missense	unknown
R9377:Palld	UTSW	8	61516657	missense	unknown
R9378:Palld	UTSW	8	61516657	missense	unknown
R9467:Palld	UTSW	8	61515230	missense	unknown
R9638:Palld	UTSW	8	61549754	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CACAGTTTGGGTTTGGCAAG -3'
(R):5'- AACCTTTGTTGAACGGGTAGC -3'

Sequencing Primer
(F):5'- TTCCTTAGTGGGTGAAAGCAG -3'
(R):5'- CGGGTAGCAATTTATTATTTTTCCTC -3'

Posted On

2016-11-09