Incidental Mutation 'R5679:Oit1'
ID442944
Institutional Source Beutler Lab
Gene Symbol Oit1
Ensembl Gene ENSMUSG00000021749
Gene Nameoncoprotein induced transcript 1
SynonymsEF-7, Fam3d, 2310076N21Rik
MMRRC Submission 043176-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5679 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location8348937-8378754 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8349305 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 215 (E215G)
Ref Sequence ENSEMBL: ENSMUSP00000022269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022269]
Predicted Effect probably damaging
Transcript: ENSMUST00000022269
AA Change: E215G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022269
Gene: ENSMUSG00000021749
AA Change: E215G

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Pfam:ILEI 98 190 3.1e-31 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a targeted mutation exhibit emotion/affect abnormalities including decreased anxiety and depression responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 G A 11: 61,217,168 R346Q probably benign Het
Bcat1 A T 6: 145,007,748 F304L probably damaging Het
Ccdc178 T G 18: 22,067,429 K439N probably benign Het
Cdkn2a T C 4: 89,276,861 D84G possibly damaging Het
Chst8 T A 7: 34,675,304 H370L probably damaging Het
Dimt1 A G 13: 106,947,600 T32A possibly damaging Het
Dph6 T C 2: 114,567,941 I162V probably benign Het
E230025N22Rik C T 18: 36,685,382 G465R possibly damaging Het
Fbxw7 T A 3: 84,977,487 N612K probably damaging Het
Gpr179 A G 11: 97,336,745 V1528A probably benign Het
Gucy2g T A 19: 55,231,079 K370N possibly damaging Het
Ipo13 A T 4: 117,894,832 W903R probably damaging Het
Itgax T A 7: 128,134,990 H311Q probably benign Het
Kmt2d T C 15: 98,854,272 probably benign Het
Lox T C 18: 52,528,917 N138S probably benign Het
Mre11a T A 9: 14,786,919 I21N probably damaging Het
Ncan T G 8: 70,112,626 Y217S probably damaging Het
Nfil3 A G 13: 52,968,491 F126L possibly damaging Het
Nfu1 T C 6: 87,019,397 V110A probably damaging Het
Olfr1009 A T 2: 85,722,046 I214F probably damaging Het
Olfr1120 T C 2: 87,357,545 F34L possibly damaging Het
Olfr513 A G 7: 108,754,996 I47V probably damaging Het
Palld T C 8: 61,684,945 Q592R possibly damaging Het
Pcdhac1 T A 18: 37,092,477 L781Q probably damaging Het
Rcl1 A G 19: 29,121,258 probably null Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Scrt1 T A 15: 76,519,062 T243S unknown Het
Slc22a30 G T 19: 8,335,771 T550K possibly damaging Het
Strc A G 2: 121,368,100 S1437P probably benign Het
Tecpr1 T A 5: 144,207,423 I654F possibly damaging Het
Tfcp2l1 A G 1: 118,668,647 M371V probably benign Het
Vmn2r11 T C 5: 109,054,842 N123S probably benign Het
Wdr81 T C 11: 75,452,923 D506G probably damaging Het
Xylt1 A G 7: 117,643,650 D640G probably damaging Het
Zfp148 T G 16: 33,495,786 M276R probably damaging Het
Zfp329 G A 7: 12,810,031 T522I probably damaging Het
Other mutations in Oit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02795:Oit1 APN 14 8355497 missense probably benign
IGL02850:Oit1 APN 14 8361475 critical splice donor site probably null
R0899:Oit1 UTSW 14 8364863 missense probably damaging 0.99
R2098:Oit1 UTSW 14 8361479 missense probably benign 0.14
R4304:Oit1 UTSW 14 8349324 missense probably damaging 1.00
R4356:Oit1 UTSW 14 8349314 missense probably damaging 1.00
R4603:Oit1 UTSW 14 8358429 missense probably damaging 0.99
R4705:Oit1 UTSW 14 8349347 missense probably benign 0.01
R5650:Oit1 UTSW 14 8357142 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTGAGTCACTGTGTGCAGG -3'
(R):5'- GAGACCCAGAGCAAGTTGTG -3'

Sequencing Primer
(F):5'- CACTGTGTGCAGGGGATGATC -3'
(R):5'- TGGCCCCATCTGTAAAATGG -3'
Posted On2016-11-09