Incidental Mutation 'R5679:Scrt1'
ID 442945
Institutional Source Beutler Lab
Gene Symbol Scrt1
Ensembl Gene ENSMUSG00000048385
Gene Name scratch family zinc finger 1
Synonyms
MMRRC Submission 043176-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.651) question?
Stock # R5679 (G1)
Quality Score 172
Status Not validated
Chromosome 15
Chromosomal Location 76400403-76406329 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 76403262 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 243 (T243S)
Ref Sequence ENSEMBL: ENSMUSP00000131152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096365] [ENSMUST00000164703]
AlphaFold Q99M85
Predicted Effect unknown
Transcript: ENSMUST00000096365
AA Change: T243S
SMART Domains Protein: ENSMUSP00000094093
Gene: ENSMUSG00000048385
AA Change: T243S

DomainStartEndE-ValueType
low complexity region 78 92 N/A INTRINSIC
ZnF_C2H2 191 213 9.58e-3 SMART
ZnF_C2H2 222 244 5.06e-2 SMART
ZnF_C2H2 248 270 6.42e-4 SMART
ZnF_C2H2 276 298 7.9e-4 SMART
ZnF_C2H2 304 324 3.47e1 SMART
low complexity region 330 341 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000164703
AA Change: T243S
SMART Domains Protein: ENSMUSP00000131152
Gene: ENSMUSG00000048385
AA Change: T243S

DomainStartEndE-ValueType
low complexity region 78 92 N/A INTRINSIC
ZnF_C2H2 191 213 9.58e-3 SMART
ZnF_C2H2 222 244 5.06e-2 SMART
ZnF_C2H2 248 270 6.42e-4 SMART
ZnF_C2H2 276 298 7.9e-4 SMART
ZnF_C2H2 304 324 3.47e1 SMART
low complexity region 330 341 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger transcriptional repressor that binds to E-box motifs. The encoded protein may promote neural differention and may be involved in cancers with neuroendocrine features. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 G A 11: 61,107,994 (GRCm39) R346Q probably benign Het
Bcat1 A T 6: 144,953,474 (GRCm39) F304L probably damaging Het
Ccdc178 T G 18: 22,200,486 (GRCm39) K439N probably benign Het
Cdkn2a T C 4: 89,195,098 (GRCm39) D84G possibly damaging Het
Chst8 T A 7: 34,374,729 (GRCm39) H370L probably damaging Het
Dimt1 A G 13: 107,084,108 (GRCm39) T32A possibly damaging Het
Dph6 T C 2: 114,398,422 (GRCm39) I162V probably benign Het
E230025N22Rik C T 18: 36,818,435 (GRCm39) G465R possibly damaging Het
Fam3d T C 14: 8,349,305 (GRCm38) E215G probably damaging Het
Fbxw7 T A 3: 84,884,794 (GRCm39) N612K probably damaging Het
Gpr179 A G 11: 97,227,571 (GRCm39) V1528A probably benign Het
Gucy2g T A 19: 55,219,511 (GRCm39) K370N possibly damaging Het
Ipo13 A T 4: 117,752,029 (GRCm39) W903R probably damaging Het
Itgax T A 7: 127,734,162 (GRCm39) H311Q probably benign Het
Kmt2d T C 15: 98,752,153 (GRCm39) probably benign Het
Lox T C 18: 52,661,989 (GRCm39) N138S probably benign Het
Mre11a T A 9: 14,698,215 (GRCm39) I21N probably damaging Het
Ncan T G 8: 70,565,276 (GRCm39) Y217S probably damaging Het
Nfil3 A G 13: 53,122,527 (GRCm39) F126L possibly damaging Het
Nfu1 T C 6: 86,996,379 (GRCm39) V110A probably damaging Het
Or12e8 T C 2: 87,187,889 (GRCm39) F34L possibly damaging Het
Or5e1 A G 7: 108,354,203 (GRCm39) I47V probably damaging Het
Or5g9 A T 2: 85,552,390 (GRCm39) I214F probably damaging Het
Palld T C 8: 62,137,979 (GRCm39) Q592R possibly damaging Het
Pcdhac1 T A 18: 37,225,530 (GRCm39) L781Q probably damaging Het
Rcl1 A G 19: 29,098,658 (GRCm39) probably null Het
Saxo1 C T 4: 86,363,272 (GRCm39) V404I possibly damaging Het
Slc22a30 G T 19: 8,313,135 (GRCm39) T550K possibly damaging Het
Strc A G 2: 121,198,581 (GRCm39) S1437P probably benign Het
Tecpr1 T A 5: 144,144,241 (GRCm39) I654F possibly damaging Het
Tfcp2l1 A G 1: 118,596,377 (GRCm39) M371V probably benign Het
Vmn2r11 T C 5: 109,202,708 (GRCm39) N123S probably benign Het
Wdr81 T C 11: 75,343,749 (GRCm39) D506G probably damaging Het
Xylt1 A G 7: 117,242,877 (GRCm39) D640G probably damaging Het
Zfp148 T G 16: 33,316,156 (GRCm39) M276R probably damaging Het
Zfp329 G A 7: 12,543,958 (GRCm39) T522I probably damaging Het
Other mutations in Scrt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Scrt1 APN 15 76,403,150 (GRCm39) missense unknown
R4676:Scrt1 UTSW 15 76,405,868 (GRCm39) missense possibly damaging 0.92
R5321:Scrt1 UTSW 15 76,403,370 (GRCm39) missense unknown
R7591:Scrt1 UTSW 15 76,403,694 (GRCm39) missense probably damaging 1.00
R7920:Scrt1 UTSW 15 76,403,417 (GRCm39) missense unknown
R8558:Scrt1 UTSW 15 76,403,843 (GRCm39) nonsense probably null
R8804:Scrt1 UTSW 15 76,403,411 (GRCm39) missense unknown
R8846:Scrt1 UTSW 15 76,405,808 (GRCm39) missense possibly damaging 0.84
R9507:Scrt1 UTSW 15 76,403,292 (GRCm39) missense unknown
Z1177:Scrt1 UTSW 15 76,403,114 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGGAAGTGCTTGAAGGCG -3'
(R):5'- TTCTTCATCACTGACGGGC -3'

Sequencing Primer
(F):5'- GCTTGAAGGCGGAGTGC -3'
(R):5'- TGCTAATGCCAACGCTGC -3'
Posted On 2016-11-09