Incidental Mutation 'R5679:Slc22a30'
ID442952
Institutional Source Beutler Lab
Gene Symbol Slc22a30
Ensembl Gene ENSMUSG00000052562
Gene Namesolute carrier family 22, member 30
Synonyms
MMRRC Submission 043176-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5679 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8335371-8405111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8335771 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 550 (T550K)
Ref Sequence ENSEMBL: ENSMUSP00000093988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064507] [ENSMUST00000096269]
Predicted Effect probably benign
Transcript: ENSMUST00000064507
AA Change: Q446K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069461
Gene: ENSMUSG00000052562
AA Change: Q446K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 439 3.1e-21 PFAM
Pfam:MFS_1 127 433 8.8e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000096269
AA Change: T550K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093988
Gene: ENSMUSG00000052562
AA Change: T550K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 9.6e-27 PFAM
Pfam:MFS_1 140 376 1.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 G A 11: 61,217,168 R346Q probably benign Het
Bcat1 A T 6: 145,007,748 F304L probably damaging Het
Ccdc178 T G 18: 22,067,429 K439N probably benign Het
Cdkn2a T C 4: 89,276,861 D84G possibly damaging Het
Chst8 T A 7: 34,675,304 H370L probably damaging Het
Dimt1 A G 13: 106,947,600 T32A possibly damaging Het
Dph6 T C 2: 114,567,941 I162V probably benign Het
E230025N22Rik C T 18: 36,685,382 G465R possibly damaging Het
Fbxw7 T A 3: 84,977,487 N612K probably damaging Het
Gpr179 A G 11: 97,336,745 V1528A probably benign Het
Gucy2g T A 19: 55,231,079 K370N possibly damaging Het
Ipo13 A T 4: 117,894,832 W903R probably damaging Het
Itgax T A 7: 128,134,990 H311Q probably benign Het
Kmt2d T C 15: 98,854,272 probably benign Het
Lox T C 18: 52,528,917 N138S probably benign Het
Mre11a T A 9: 14,786,919 I21N probably damaging Het
Ncan T G 8: 70,112,626 Y217S probably damaging Het
Nfil3 A G 13: 52,968,491 F126L possibly damaging Het
Nfu1 T C 6: 87,019,397 V110A probably damaging Het
Oit1 T C 14: 8,349,305 E215G probably damaging Het
Olfr1009 A T 2: 85,722,046 I214F probably damaging Het
Olfr1120 T C 2: 87,357,545 F34L possibly damaging Het
Olfr513 A G 7: 108,754,996 I47V probably damaging Het
Palld T C 8: 61,684,945 Q592R possibly damaging Het
Pcdhac1 T A 18: 37,092,477 L781Q probably damaging Het
Rcl1 A G 19: 29,121,258 probably null Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Scrt1 T A 15: 76,519,062 T243S unknown Het
Strc A G 2: 121,368,100 S1437P probably benign Het
Tecpr1 T A 5: 144,207,423 I654F possibly damaging Het
Tfcp2l1 A G 1: 118,668,647 M371V probably benign Het
Vmn2r11 T C 5: 109,054,842 N123S probably benign Het
Wdr81 T C 11: 75,452,923 D506G probably damaging Het
Xylt1 A G 7: 117,643,650 D640G probably damaging Het
Zfp148 T G 16: 33,495,786 M276R probably damaging Het
Zfp329 G A 7: 12,810,031 T522I probably damaging Het
Other mutations in Slc22a30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Slc22a30 APN 19 8335788 missense probably benign 0.29
IGL01894:Slc22a30 APN 19 8386657 missense probably benign 0.28
IGL02795:Slc22a30 APN 19 8400895 missense probably damaging 1.00
IGL02798:Slc22a30 APN 19 8370085 missense probably damaging 0.96
IGL03267:Slc22a30 APN 19 8337958 missense probably benign 0.00
R0089:Slc22a30 UTSW 19 8370197 missense probably benign 0.03
R0243:Slc22a30 UTSW 19 8345357 missense probably benign 0.01
R1033:Slc22a30 UTSW 19 8335801 nonsense probably null
R1781:Slc22a30 UTSW 19 8335772 missense probably damaging 1.00
R2098:Slc22a30 UTSW 19 8400811 missense probably damaging 1.00
R3874:Slc22a30 UTSW 19 8336849 missense probably benign 0.31
R4091:Slc22a30 UTSW 19 8404545 missense probably damaging 1.00
R4799:Slc22a30 UTSW 19 8344404 missense probably benign
R5108:Slc22a30 UTSW 19 8386426 missense probably damaging 1.00
R5191:Slc22a30 UTSW 19 8344393 nonsense probably null
R5192:Slc22a30 UTSW 19 8344393 nonsense probably null
R5193:Slc22a30 UTSW 19 8344393 nonsense probably null
R5195:Slc22a30 UTSW 19 8344393 nonsense probably null
R5253:Slc22a30 UTSW 19 8344393 nonsense probably null
R5254:Slc22a30 UTSW 19 8344393 nonsense probably null
R5255:Slc22a30 UTSW 19 8344393 nonsense probably null
R5256:Slc22a30 UTSW 19 8344393 nonsense probably null
R5377:Slc22a30 UTSW 19 8344393 nonsense probably null
R5378:Slc22a30 UTSW 19 8344393 nonsense probably null
R5400:Slc22a30 UTSW 19 8344393 nonsense probably null
R5401:Slc22a30 UTSW 19 8344393 nonsense probably null
R5481:Slc22a30 UTSW 19 8336837 missense probably benign 0.01
R5644:Slc22a30 UTSW 19 8404616 missense possibly damaging 0.72
R5699:Slc22a30 UTSW 19 8344393 nonsense probably null
R5704:Slc22a30 UTSW 19 8344393 nonsense probably null
R5706:Slc22a30 UTSW 19 8344393 nonsense probably null
R5767:Slc22a30 UTSW 19 8344393 nonsense probably null
R5770:Slc22a30 UTSW 19 8386527 missense probably damaging 0.99
R5784:Slc22a30 UTSW 19 8344393 nonsense probably null
R5793:Slc22a30 UTSW 19 8336819 missense possibly damaging 0.95
R5813:Slc22a30 UTSW 19 8404581 missense probably benign 0.07
R6101:Slc22a30 UTSW 19 8337868 splice site probably null
R6105:Slc22a30 UTSW 19 8337868 splice site probably null
R6327:Slc22a30 UTSW 19 8335722 utr 3 prime probably benign
R6958:Slc22a30 UTSW 19 8386701 missense probably damaging 0.98
R7162:Slc22a30 UTSW 19 8336717 splice site probably null
R7375:Slc22a30 UTSW 19 8404691 missense probably damaging 1.00
R7572:Slc22a30 UTSW 19 8335708 missense unknown
R7755:Slc22a30 UTSW 19 8336769 missense probably damaging 1.00
R8114:Slc22a30 UTSW 19 8404540 nonsense probably null
R8248:Slc22a30 UTSW 19 8370199 missense probably benign 0.12
R8677:Slc22a30 UTSW 19 8386671 missense probably benign 0.21
R8854:Slc22a30 UTSW 19 8386390 critical splice donor site probably null
R8900:Slc22a30 UTSW 19 8337976 missense probably damaging 1.00
Z1088:Slc22a30 UTSW 19 8335775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGCAATTAGAATGTGATCTGTG -3'
(R):5'- GTAATCCCCTGGAACCAACG -3'

Sequencing Primer
(F):5'- GCAATTAGAATGTGATCTGTGTTTTC -3'
(R):5'- CTGGAACCAACGTGTAAAGTAC -3'
Posted On2016-11-09