Incidental Mutation 'R5679:Gucy2g'
ID 442954
Institutional Source Beutler Lab
Gene Symbol Gucy2g
Ensembl Gene ENSMUSG00000055523
Gene Name guanylate cyclase 2g
Synonyms GC-G, 2410077I05Rik
MMRRC Submission 043176-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5679 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 55198297-55241236 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55231079 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 370 (K370N)
Ref Sequence ENSEMBL: ENSMUSP00000068253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069183]
AlphaFold Q6TL19
Predicted Effect possibly damaging
Transcript: ENSMUST00000069183
AA Change: K370N

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068253
Gene: ENSMUSG00000055523
AA Change: K370N

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
Pfam:ANF_receptor 65 416 5.2e-36 PFAM
low complexity region 471 487 N/A INTRINSIC
Pfam:Pkinase 574 826 2e-26 PFAM
Pfam:Pkinase_Tyr 577 826 6e-35 PFAM
CYCc 865 1059 6.42e-96 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities and are protected against acute ischemia induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 G A 11: 61,217,168 R346Q probably benign Het
Bcat1 A T 6: 145,007,748 F304L probably damaging Het
Ccdc178 T G 18: 22,067,429 K439N probably benign Het
Cdkn2a T C 4: 89,276,861 D84G possibly damaging Het
Chst8 T A 7: 34,675,304 H370L probably damaging Het
Dimt1 A G 13: 106,947,600 T32A possibly damaging Het
Dph6 T C 2: 114,567,941 I162V probably benign Het
E230025N22Rik C T 18: 36,685,382 G465R possibly damaging Het
Fbxw7 T A 3: 84,977,487 N612K probably damaging Het
Gpr179 A G 11: 97,336,745 V1528A probably benign Het
Ipo13 A T 4: 117,894,832 W903R probably damaging Het
Itgax T A 7: 128,134,990 H311Q probably benign Het
Kmt2d T C 15: 98,854,272 probably benign Het
Lox T C 18: 52,528,917 N138S probably benign Het
Mre11a T A 9: 14,786,919 I21N probably damaging Het
Ncan T G 8: 70,112,626 Y217S probably damaging Het
Nfil3 A G 13: 52,968,491 F126L possibly damaging Het
Nfu1 T C 6: 87,019,397 V110A probably damaging Het
Oit1 T C 14: 8,349,305 E215G probably damaging Het
Olfr1009 A T 2: 85,722,046 I214F probably damaging Het
Olfr1120 T C 2: 87,357,545 F34L possibly damaging Het
Olfr513 A G 7: 108,754,996 I47V probably damaging Het
Palld T C 8: 61,684,945 Q592R possibly damaging Het
Pcdhac1 T A 18: 37,092,477 L781Q probably damaging Het
Rcl1 A G 19: 29,121,258 probably null Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Scrt1 T A 15: 76,519,062 T243S unknown Het
Slc22a30 G T 19: 8,335,771 T550K possibly damaging Het
Strc A G 2: 121,368,100 S1437P probably benign Het
Tecpr1 T A 5: 144,207,423 I654F possibly damaging Het
Tfcp2l1 A G 1: 118,668,647 M371V probably benign Het
Vmn2r11 T C 5: 109,054,842 N123S probably benign Het
Wdr81 T C 11: 75,452,923 D506G probably damaging Het
Xylt1 A G 7: 117,643,650 D640G probably damaging Het
Zfp148 T G 16: 33,495,786 M276R probably damaging Het
Zfp329 G A 7: 12,810,031 T522I probably damaging Het
Other mutations in Gucy2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Gucy2g APN 19 55233103 missense probably benign 0.01
IGL01954:Gucy2g APN 19 55198691 missense probably benign 0.01
IGL01969:Gucy2g APN 19 55227438 missense probably benign 0.00
IGL02164:Gucy2g APN 19 55238023 missense probably benign
IGL02534:Gucy2g APN 19 55241068 missense probably damaging 1.00
IGL02667:Gucy2g APN 19 55206177 missense possibly damaging 0.64
IGL02755:Gucy2g APN 19 55210354 missense probably benign 0.10
IGL03187:Gucy2g APN 19 55231052 missense possibly damaging 0.91
IGL03354:Gucy2g APN 19 55233080 missense possibly damaging 0.95
PIT4366001:Gucy2g UTSW 19 55237782 missense probably null 0.51
R0040:Gucy2g UTSW 19 55217302 missense possibly damaging 0.73
R0126:Gucy2g UTSW 19 55241166 missense probably benign
R0318:Gucy2g UTSW 19 55237798 missense probably benign 0.00
R0576:Gucy2g UTSW 19 55198770 missense probably damaging 1.00
R0604:Gucy2g UTSW 19 55203087 missense probably benign 0.00
R0962:Gucy2g UTSW 19 55210284 nonsense probably null
R1348:Gucy2g UTSW 19 55222906 missense possibly damaging 0.68
R1458:Gucy2g UTSW 19 55215036 splice site probably benign
R1693:Gucy2g UTSW 19 55222926 missense probably damaging 1.00
R1795:Gucy2g UTSW 19 55199541 missense probably damaging 1.00
R1804:Gucy2g UTSW 19 55210309 missense probably benign 0.34
R1830:Gucy2g UTSW 19 55222930 missense possibly damaging 0.94
R1902:Gucy2g UTSW 19 55210237 missense probably benign 0.20
R1927:Gucy2g UTSW 19 55237759 missense probably benign 0.02
R1969:Gucy2g UTSW 19 55222896 missense possibly damaging 0.90
R1969:Gucy2g UTSW 19 55233053 missense probably benign 0.42
R2071:Gucy2g UTSW 19 55222340 missense possibly damaging 0.72
R2842:Gucy2g UTSW 19 55240947 missense probably damaging 1.00
R2971:Gucy2g UTSW 19 55210276 missense probably damaging 1.00
R4202:Gucy2g UTSW 19 55229769 missense possibly damaging 0.96
R4405:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4407:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4614:Gucy2g UTSW 19 55202147 nonsense probably null
R4671:Gucy2g UTSW 19 55238068 missense probably damaging 1.00
R4684:Gucy2g UTSW 19 55206256 missense probably damaging 1.00
R4837:Gucy2g UTSW 19 55226053 missense probably benign
R4969:Gucy2g UTSW 19 55226013 missense probably benign
R5050:Gucy2g UTSW 19 55240935 missense probably benign 0.05
R5059:Gucy2g UTSW 19 55226071 missense probably benign 0.00
R5070:Gucy2g UTSW 19 55229787 missense probably damaging 0.98
R5288:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5384:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5386:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5497:Gucy2g UTSW 19 55198701 missense probably benign 0.00
R5531:Gucy2g UTSW 19 55241140 missense probably benign 0.24
R5536:Gucy2g UTSW 19 55237927 missense probably benign 0.05
R5715:Gucy2g UTSW 19 55233155 missense possibly damaging 0.93
R5941:Gucy2g UTSW 19 55215131 missense probably damaging 1.00
R6250:Gucy2g UTSW 19 55217424 missense probably damaging 0.99
R6288:Gucy2g UTSW 19 55227513 missense probably benign 0.01
R6378:Gucy2g UTSW 19 55240945 missense probably benign 0.00
R6605:Gucy2g UTSW 19 55241028 missense probably damaging 1.00
R7020:Gucy2g UTSW 19 55233050 missense probably damaging 0.98
R7064:Gucy2g UTSW 19 55210332 missense probably benign 0.01
R7078:Gucy2g UTSW 19 55241151 missense probably damaging 1.00
R7402:Gucy2g UTSW 19 55206293 missense probably damaging 1.00
R7539:Gucy2g UTSW 19 55203154 missense probably damaging 0.99
R7561:Gucy2g UTSW 19 55206340 missense probably benign 0.38
R7583:Gucy2g UTSW 19 55235615 missense probably damaging 1.00
R7804:Gucy2g UTSW 19 55228152 missense probably benign 0.02
R7880:Gucy2g UTSW 19 55206280 missense probably damaging 1.00
R8442:Gucy2g UTSW 19 55217401 missense probably benign 0.00
R8559:Gucy2g UTSW 19 55210354 missense probably benign 0.10
R8970:Gucy2g UTSW 19 55203046 missense possibly damaging 0.56
R8972:Gucy2g UTSW 19 55237974 missense probably benign 0.17
R9085:Gucy2g UTSW 19 55233165 nonsense probably null
R9390:Gucy2g UTSW 19 55202175 missense probably null 1.00
R9462:Gucy2g UTSW 19 55233037 critical splice donor site probably null
R9502:Gucy2g UTSW 19 55210384 missense probably damaging 1.00
R9610:Gucy2g UTSW 19 55206173 missense probably damaging 1.00
R9611:Gucy2g UTSW 19 55206173 missense probably damaging 1.00
R9644:Gucy2g UTSW 19 55231105 missense probably benign 0.05
Z1177:Gucy2g UTSW 19 55210377 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGAAGCTCTAAGCCCATATGC -3'
(R):5'- AGGTTTGCTATCATCCGGTG -3'

Sequencing Primer
(F):5'- TGCCCTATGGAAAACTGGAATTGTG -3'
(R):5'- ACACACACACTGGCGTGG -3'
Posted On 2016-11-09