Incidental Mutation 'R5680:Tagln2'
ID442957
Institutional Source Beutler Lab
Gene Symbol Tagln2
Ensembl Gene ENSMUSG00000026547
Gene Nametransgelin 2
SynonymsSm22B, 2700094C18Rik
MMRRC Submission 043177-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5680 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172500047-172507380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172505912 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 111 (F111S)
Ref Sequence ENSEMBL: ENSMUSP00000106861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111228] [ENSMUST00000111230] [ENSMUST00000192460]
Predicted Effect probably damaging
Transcript: ENSMUST00000111228
AA Change: F111S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106859
Gene: ENSMUSG00000026547
AA Change: F111S

DomainStartEndE-ValueType
CH 26 132 2.84e-24 SMART
Pfam:Calponin 174 198 7e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111230
AA Change: F111S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106861
Gene: ENSMUSG00000026547
AA Change: F111S

DomainStartEndE-ValueType
CH 26 132 2.84e-24 SMART
Pfam:Calponin 174 199 1.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138296
Predicted Effect probably benign
Transcript: ENSMUST00000192460
SMART Domains Protein: ENSMUSP00000141983
Gene: ENSMUSG00000026547

DomainStartEndE-ValueType
Pfam:CH 27 90 9.2e-10 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to the protein transgelin, which is one of the earliest markers of differentiated smooth muscle. The specific function of this protein has not yet been determined, although it is thought to be a tumor suppressor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in T cell physiology including cytotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
Abca6 A G 11: 110,236,645 F362S possibly damaging Het
Adcy1 G A 11: 7,109,020 V309M probably damaging Het
Agap2 A G 10: 127,088,011 K752E unknown Het
Ahdc1 T A 4: 133,065,596 F1383I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Atn1 A T 6: 124,747,815 S152T possibly damaging Het
Bcl11a G A 11: 24,164,264 V536M possibly damaging Het
Cdc20 T C 4: 118,433,067 T466A probably damaging Het
Cecr2 C G 6: 120,761,426 T1010R probably benign Het
Cfap54 A T 10: 92,979,017 L1318* probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Dnah6 A G 6: 73,149,525 V1273A probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
G3bp2 T C 5: 92,068,360 R106G probably damaging Het
Ggt7 A T 2: 155,506,433 C100S probably damaging Het
Gm765 T A 6: 98,248,226 Q32L probably damaging Het
Grik4 A T 9: 42,629,119 M255K probably benign Het
Kcnj11 A T 7: 46,098,808 S364T probably benign Het
Lnpep A T 17: 17,579,182 Y70* probably null Het
Mark1 T C 1: 184,944,816 H79R probably damaging Het
Myo9b T G 8: 71,290,372 S26A probably benign Het
Pa2g4 G T 10: 128,559,457 N306K probably benign Het
Pik3c3 T A 18: 30,277,113 Y133* probably null Het
Prpf6 G T 2: 181,649,140 A675S probably damaging Het
Psca A G 15: 74,716,099 D44G probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Scn10a A G 9: 119,624,136 L1231P probably damaging Het
Sirpa T C 2: 129,616,252 S157P probably benign Het
Slc27a2 A T 2: 126,561,610 R184S probably benign Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tert T A 13: 73,642,351 probably null Het
Togaram2 G A 17: 71,689,209 R68K probably benign Het
Trim40 A T 17: 36,888,982 I68N probably damaging Het
Trpa1 T C 1: 14,875,854 M1018V probably benign Het
Unc13c A T 9: 73,932,602 N322K probably damaging Het
Vmn2r75 T A 7: 86,171,571 T52S probably benign Het
Vmn2r90 T G 17: 17,726,772 V437G possibly damaging Het
Vps16 C A 2: 130,440,324 H389N possibly damaging Het
Other mutations in Tagln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0468:Tagln2 UTSW 1 172506221 missense probably benign 0.23
R1576:Tagln2 UTSW 1 172505221 missense probably benign 0.02
R6860:Tagln2 UTSW 1 172505909 missense probably benign 0.32
R7149:Tagln2 UTSW 1 172505819 missense probably damaging 0.98
R7554:Tagln2 UTSW 1 172505844 missense probably damaging 1.00
R7977:Tagln2 UTSW 1 172505253 missense probably benign
R7987:Tagln2 UTSW 1 172505253 missense probably benign
R8083:Tagln2 UTSW 1 172505199 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGTTCTCTGACCTTCAGTAGTC -3'
(R):5'- TCTGTCGCTAGGTCTGCAAG -3'

Sequencing Primer
(F):5'- TGACCTTCAGTAGTCCCATCC -3'
(R):5'- TAGGTCTGCAAGCCTGGCATC -3'
Posted On2016-11-09