Incidental Mutation 'R5680:Cdc20'
ID442968
Institutional Source Beutler Lab
Gene Symbol Cdc20
Ensembl Gene ENSMUSG00000006398
Gene Namecell division cycle 20
Synonymsp55CDC, 2310042N09Rik
MMRRC Submission 043177-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5680 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118432901-118437352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118433067 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 466 (T466A)
Ref Sequence ENSEMBL: ENSMUSP00000006565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006557] [ENSMUST00000006565] [ENSMUST00000067896] [ENSMUST00000102673] [ENSMUST00000167636]
Predicted Effect probably benign
Transcript: ENSMUST00000006557
SMART Domains Protein: ENSMUSP00000006557
Gene: ENSMUSG00000006390

DomainStartEndE-ValueType
Pfam:ELO 23 263 3.1e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000006565
AA Change: T466A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006565
Gene: ENSMUSG00000006398
AA Change: T466A

DomainStartEndE-ValueType
WD40 169 210 7.36e1 SMART
WD40 215 254 3.64e-2 SMART
WD40 257 294 9.6e-2 SMART
WD40 298 337 1.62e-8 SMART
WD40 344 386 8.29e-6 SMART
WD40 389 429 2.21e1 SMART
WD40 432 471 7.85e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067896
SMART Domains Protein: ENSMUSP00000064816
Gene: ENSMUSG00000006390

DomainStartEndE-ValueType
Pfam:ELO 23 262 8.5e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102673
SMART Domains Protein: ENSMUSP00000099734
Gene: ENSMUSG00000006390

DomainStartEndE-ValueType
Pfam:ELO 2 186 5.8e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151302
Predicted Effect probably benign
Transcript: ENSMUST00000167636
SMART Domains Protein: ENSMUSP00000126685
Gene: ENSMUSG00000006390

DomainStartEndE-ValueType
Pfam:ELO 23 263 3.1e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183942
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CDC20 appears to act as a regulatory protein interacting with several other proteins at multiple points in the cell cycle. It is required for two microtubule-dependent processes, nuclear movement prior to anaphase and chromosome separation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene display embryonic lethality with cell cycle abnormalities. Mice heterozygous for a mutation in this gene display increased tumor incidence and increased incidence of aneuploidy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
Abca6 A G 11: 110,236,645 F362S possibly damaging Het
Adcy1 G A 11: 7,109,020 V309M probably damaging Het
Agap2 A G 10: 127,088,011 K752E unknown Het
Ahdc1 T A 4: 133,065,596 F1383I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Atn1 A T 6: 124,747,815 S152T possibly damaging Het
Bcl11a G A 11: 24,164,264 V536M possibly damaging Het
Cecr2 C G 6: 120,761,426 T1010R probably benign Het
Cfap54 A T 10: 92,979,017 L1318* probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Dnah6 A G 6: 73,149,525 V1273A probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
G3bp2 T C 5: 92,068,360 R106G probably damaging Het
Ggt7 A T 2: 155,506,433 C100S probably damaging Het
Gm765 T A 6: 98,248,226 Q32L probably damaging Het
Grik4 A T 9: 42,629,119 M255K probably benign Het
Kcnj11 A T 7: 46,098,808 S364T probably benign Het
Lnpep A T 17: 17,579,182 Y70* probably null Het
Mark1 T C 1: 184,944,816 H79R probably damaging Het
Myo9b T G 8: 71,290,372 S26A probably benign Het
Pa2g4 G T 10: 128,559,457 N306K probably benign Het
Pik3c3 T A 18: 30,277,113 Y133* probably null Het
Prpf6 G T 2: 181,649,140 A675S probably damaging Het
Psca A G 15: 74,716,099 D44G probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Scn10a A G 9: 119,624,136 L1231P probably damaging Het
Sirpa T C 2: 129,616,252 S157P probably benign Het
Slc27a2 A T 2: 126,561,610 R184S probably benign Het
Tagln2 T C 1: 172,505,912 F111S probably damaging Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tert T A 13: 73,642,351 probably null Het
Togaram2 G A 17: 71,689,209 R68K probably benign Het
Trim40 A T 17: 36,888,982 I68N probably damaging Het
Trpa1 T C 1: 14,875,854 M1018V probably benign Het
Unc13c A T 9: 73,932,602 N322K probably damaging Het
Vmn2r75 T A 7: 86,171,571 T52S probably benign Het
Vmn2r90 T G 17: 17,726,772 V437G possibly damaging Het
Vps16 C A 2: 130,440,324 H389N possibly damaging Het
Other mutations in Cdc20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Cdc20 APN 4 118435552 missense possibly damaging 0.84
R0022:Cdc20 UTSW 4 118435489 missense probably damaging 1.00
R0022:Cdc20 UTSW 4 118435489 missense probably damaging 1.00
R1482:Cdc20 UTSW 4 118437056 missense probably benign 0.00
R1513:Cdc20 UTSW 4 118433107 missense probably damaging 1.00
R2107:Cdc20 UTSW 4 118433513 missense probably damaging 1.00
R2242:Cdc20 UTSW 4 118433525 missense probably benign 0.19
R4237:Cdc20 UTSW 4 118433060 missense probably damaging 0.99
R4238:Cdc20 UTSW 4 118433060 missense probably damaging 0.99
R4629:Cdc20 UTSW 4 118433564 missense probably damaging 1.00
R4793:Cdc20 UTSW 4 118437064 missense probably benign 0.28
R4897:Cdc20 UTSW 4 118435832 missense probably benign
R5279:Cdc20 UTSW 4 118433514 missense probably damaging 1.00
R5635:Cdc20 UTSW 4 118436027 missense possibly damaging 0.95
R5715:Cdc20 UTSW 4 118434818 missense probably damaging 1.00
R5782:Cdc20 UTSW 4 118433042 missense probably benign 0.36
R6323:Cdc20 UTSW 4 118435564 missense probably damaging 1.00
R7761:Cdc20 UTSW 4 118435989 missense possibly damaging 0.74
R8317:Cdc20 UTSW 4 118437126 unclassified probably benign
R8548:Cdc20 UTSW 4 118436338 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- CTCTAGTCAGAGTAGGGGAAGC -3'
(R):5'- TGAGCTCAAAGGTAGGTGGC -3'

Sequencing Primer
(F):5'- CATGTAGGAAGGATGCTGGGAC -3'
(R):5'- ACAGACTGATATGACTTGCCTGG -3'
Posted On2016-11-09