Incidental Mutation 'R5680:Kcnj11'
ID442977
Institutional Source Beutler Lab
Gene Symbol Kcnj11
Ensembl Gene ENSMUSG00000096146
Gene Namepotassium inwardly rectifying channel, subfamily J, member 11
SynonymsKir6.2
MMRRC Submission 043177-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5680 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location46093953-46100764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46098808 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 364 (S364T)
Ref Sequence ENSEMBL: ENSMUSP00000147439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180081] [ENSMUST00000209291] [ENSMUST00000209881] [ENSMUST00000211674]
Predicted Effect probably benign
Transcript: ENSMUST00000180081
SMART Domains Protein: ENSMUSP00000136002
Gene: ENSMUSG00000096146

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
Pfam:IRK 36 360 4.9e-138 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209863
Predicted Effect probably benign
Transcript: ENSMUST00000209881
Predicted Effect probably benign
Transcript: ENSMUST00000211674
AA Change: S364T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and is found associated with the sulfonylurea receptor SUR. Mutations in this gene are a cause of familial persistent hyperinsulinemic hypoglycemia of infancy (PHHI), an autosomal recessive disorder characterized by unregulated insulin secretion. Defects in this gene may also contribute to autosomal dominant non-insulin-dependent diabetes mellitus type II (NIDDM), transient neonatal diabetes mellitus type 3 (TNDM3), and permanent neonatal diabetes mellitus (PNDM). Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired insulin secretion, mild glucose intolerance, reduced glucagon secretion in response to hypoglycemia, hypoxia-induced seizure susceptibility, and stress-induced arrhythmia and sudden death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
Abca6 A G 11: 110,236,645 F362S possibly damaging Het
Adcy1 G A 11: 7,109,020 V309M probably damaging Het
Agap2 A G 10: 127,088,011 K752E unknown Het
Ahdc1 T A 4: 133,065,596 F1383I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Atn1 A T 6: 124,747,815 S152T possibly damaging Het
Bcl11a G A 11: 24,164,264 V536M possibly damaging Het
Cdc20 T C 4: 118,433,067 T466A probably damaging Het
Cecr2 C G 6: 120,761,426 T1010R probably benign Het
Cfap54 A T 10: 92,979,017 L1318* probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Dnah6 A G 6: 73,149,525 V1273A probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
G3bp2 T C 5: 92,068,360 R106G probably damaging Het
Ggt7 A T 2: 155,506,433 C100S probably damaging Het
Gm765 T A 6: 98,248,226 Q32L probably damaging Het
Grik4 A T 9: 42,629,119 M255K probably benign Het
Lnpep A T 17: 17,579,182 Y70* probably null Het
Mark1 T C 1: 184,944,816 H79R probably damaging Het
Myo9b T G 8: 71,290,372 S26A probably benign Het
Pa2g4 G T 10: 128,559,457 N306K probably benign Het
Pik3c3 T A 18: 30,277,113 Y133* probably null Het
Prpf6 G T 2: 181,649,140 A675S probably damaging Het
Psca A G 15: 74,716,099 D44G probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Scn10a A G 9: 119,624,136 L1231P probably damaging Het
Sirpa T C 2: 129,616,252 S157P probably benign Het
Slc27a2 A T 2: 126,561,610 R184S probably benign Het
Tagln2 T C 1: 172,505,912 F111S probably damaging Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tert T A 13: 73,642,351 probably null Het
Togaram2 G A 17: 71,689,209 R68K probably benign Het
Trim40 A T 17: 36,888,982 I68N probably damaging Het
Trpa1 T C 1: 14,875,854 M1018V probably benign Het
Unc13c A T 9: 73,932,602 N322K probably damaging Het
Vmn2r75 T A 7: 86,171,571 T52S probably benign Het
Vmn2r90 T G 17: 17,726,772 V437G possibly damaging Het
Vps16 C A 2: 130,440,324 H389N possibly damaging Het
Other mutations in Kcnj11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Kcnj11 APN 7 46098769 missense probably benign 0.02
IGL01767:Kcnj11 APN 7 46099065 missense probably benign 0.05
IGL01950:Kcnj11 APN 7 46099149 missense probably damaging 1.00
IGL02388:Kcnj11 APN 7 46099789 missense probably benign 0.22
R0019:Kcnj11 UTSW 7 46098939 missense probably benign 0.34
R0710:Kcnj11 UTSW 7 46099125 missense probably benign 0.00
R1216:Kcnj11 UTSW 7 46099861 missense probably benign 0.00
R1819:Kcnj11 UTSW 7 46099156 missense probably benign
R2155:Kcnj11 UTSW 7 46099357 missense probably damaging 1.00
R3148:Kcnj11 UTSW 7 46099120 missense probably benign 0.00
R3498:Kcnj11 UTSW 7 46099602 missense probably damaging 1.00
R4128:Kcnj11 UTSW 7 46099719 missense probably damaging 1.00
R4766:Kcnj11 UTSW 7 46099816 missense probably benign
R4926:Kcnj11 UTSW 7 46099120 missense probably benign 0.00
R5708:Kcnj11 UTSW 7 46099818 missense probably benign 0.00
R7487:Kcnj11 UTSW 7 46098841 missense probably benign 0.01
R7788:Kcnj11 UTSW 7 46099755 missense probably damaging 1.00
R7816:Kcnj11 UTSW 7 46099857 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTATCTTGTAACACCCCAGAC -3'
(R):5'- GCTGACGAGATTCTATGGGG -3'

Sequencing Primer
(F):5'- GGTCTTGTCCCACACCAGAC -3'
(R):5'- CGAGATTCTATGGGGGCAGC -3'
Posted On2016-11-09