Incidental Mutation 'R5680:Colec11'
ID442992
Institutional Source Beutler Lab
Gene Symbol Colec11
Ensembl Gene ENSMUSG00000036655
Gene Namecollectin sub-family member 11
Synonyms
MMRRC Submission 043177-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5680 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location28594173-28623377 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28594731 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 249 (S249P)
Ref Sequence ENSEMBL: ENSMUSP00000049285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036136] [ENSMUST00000220655] [ENSMUST00000220836]
Predicted Effect probably damaging
Transcript: ENSMUST00000036136
AA Change: S249P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049285
Gene: ENSMUSG00000036655
AA Change: S249P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Collagen 40 88 5.8e-10 PFAM
Pfam:Collagen 60 116 4.7e-11 PFAM
CLECT 139 266 1.74e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220655
Predicted Effect probably damaging
Transcript: ENSMUST00000220836
AA Change: S255P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the collectin family of C-type lectins that possess collagen-like sequences and carbohydrate recognition domains. Collectins are secreted proteins that play important roles in the innate immune system by binding to carbohydrate antigens on microorganisms, facilitating their recognition and removal. The encoded protein binds to multiple sugars with a preference for fucose and mannose. Mutations in the human gene are a cause of 3MC syndrome-2. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased susceptibility to kidney reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
Abca6 A G 11: 110,236,645 F362S possibly damaging Het
Adcy1 G A 11: 7,109,020 V309M probably damaging Het
Agap2 A G 10: 127,088,011 K752E unknown Het
Ahdc1 T A 4: 133,065,596 F1383I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Atn1 A T 6: 124,747,815 S152T possibly damaging Het
Bcl11a G A 11: 24,164,264 V536M possibly damaging Het
Cdc20 T C 4: 118,433,067 T466A probably damaging Het
Cecr2 C G 6: 120,761,426 T1010R probably benign Het
Cfap54 A T 10: 92,979,017 L1318* probably null Het
Dnah6 A G 6: 73,149,525 V1273A probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
G3bp2 T C 5: 92,068,360 R106G probably damaging Het
Ggt7 A T 2: 155,506,433 C100S probably damaging Het
Gm765 T A 6: 98,248,226 Q32L probably damaging Het
Grik4 A T 9: 42,629,119 M255K probably benign Het
Kcnj11 A T 7: 46,098,808 S364T probably benign Het
Lnpep A T 17: 17,579,182 Y70* probably null Het
Mark1 T C 1: 184,944,816 H79R probably damaging Het
Myo9b T G 8: 71,290,372 S26A probably benign Het
Pa2g4 G T 10: 128,559,457 N306K probably benign Het
Pik3c3 T A 18: 30,277,113 Y133* probably null Het
Prpf6 G T 2: 181,649,140 A675S probably damaging Het
Psca A G 15: 74,716,099 D44G probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Scn10a A G 9: 119,624,136 L1231P probably damaging Het
Sirpa T C 2: 129,616,252 S157P probably benign Het
Slc27a2 A T 2: 126,561,610 R184S probably benign Het
Tagln2 T C 1: 172,505,912 F111S probably damaging Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tert T A 13: 73,642,351 probably null Het
Togaram2 G A 17: 71,689,209 R68K probably benign Het
Trim40 A T 17: 36,888,982 I68N probably damaging Het
Trpa1 T C 1: 14,875,854 M1018V probably benign Het
Unc13c A T 9: 73,932,602 N322K probably damaging Het
Vmn2r75 T A 7: 86,171,571 T52S probably benign Het
Vmn2r90 T G 17: 17,726,772 V437G possibly damaging Het
Vps16 C A 2: 130,440,324 H389N possibly damaging Het
Other mutations in Colec11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Colec11 APN 12 28594868 missense probably damaging 1.00
IGL01990:Colec11 APN 12 28594986 missense probably benign 0.30
philatelist UTSW 12 28595242 critical splice donor site probably null
R0759:Colec11 UTSW 12 28594731 missense probably damaging 1.00
R1796:Colec11 UTSW 12 28594859 missense probably damaging 1.00
R2086:Colec11 UTSW 12 28594787 missense probably damaging 0.99
R2926:Colec11 UTSW 12 28617429 missense probably damaging 0.99
R3624:Colec11 UTSW 12 28594908 missense probably benign 0.00
R4078:Colec11 UTSW 12 28595247 missense possibly damaging 0.75
R6768:Colec11 UTSW 12 28595101 splice site probably null
R7296:Colec11 UTSW 12 28594715 missense probably damaging 1.00
R7758:Colec11 UTSW 12 28595242 critical splice donor site probably null
R7899:Colec11 UTSW 12 28595282 missense probably damaging 1.00
R8384:Colec11 UTSW 12 28594659 makesense probably null
RF019:Colec11 UTSW 12 28612883 missense probably benign 0.29
Z1176:Colec11 UTSW 12 28595284 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTTCAAACAGCCCTTCCAACTG -3'
(R):5'- ATGGCTTCATACCTGGCAC -3'

Sequencing Primer
(F):5'- GCCCTTCCAACTGTCAATGAGG -3'
(R):5'- GGAGAAAGAAGGTGCTTTC -3'
Posted On2016-11-09