Incidental Mutation 'R5680:Tert'
ID442993
Institutional Source Beutler Lab
Gene Symbol Tert
Ensembl Gene ENSMUSG00000021611
Gene Nametelomerase reverse transcriptase
SynonymsTR
MMRRC Submission 043177-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.553) question?
Stock #R5680 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location73626911-73649843 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 73642351 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022104] [ENSMUST00000221522] [ENSMUST00000223303]
Predicted Effect probably null
Transcript: ENSMUST00000022104
SMART Domains Protein: ENSMUSP00000022104
Gene: ENSMUSG00000021611

DomainStartEndE-ValueType
Blast:Telomerase_RBD 329 375 2e-6 BLAST
Telomerase_RBD 449 584 5.02e-75 SMART
Blast:Telomerase_RBD 651 688 1e-5 BLAST
Pfam:RVT_1 787 918 6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221522
Predicted Effect probably benign
Transcript: ENSMUST00000222251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222912
Predicted Effect probably benign
Transcript: ENSMUST00000223303
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified; the full-length sequence of some variants has not been determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: In spite of impaired telomerase function, homozygous mutant mice are overtly normal in early generations. Impaired fertility has been reported in later generations for homozygotes of at least one knockout allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
Abca6 A G 11: 110,236,645 F362S possibly damaging Het
Adcy1 G A 11: 7,109,020 V309M probably damaging Het
Agap2 A G 10: 127,088,011 K752E unknown Het
Ahdc1 T A 4: 133,065,596 F1383I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Atn1 A T 6: 124,747,815 S152T possibly damaging Het
Bcl11a G A 11: 24,164,264 V536M possibly damaging Het
Cdc20 T C 4: 118,433,067 T466A probably damaging Het
Cecr2 C G 6: 120,761,426 T1010R probably benign Het
Cfap54 A T 10: 92,979,017 L1318* probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Dnah6 A G 6: 73,149,525 V1273A probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
G3bp2 T C 5: 92,068,360 R106G probably damaging Het
Ggt7 A T 2: 155,506,433 C100S probably damaging Het
Gm765 T A 6: 98,248,226 Q32L probably damaging Het
Grik4 A T 9: 42,629,119 M255K probably benign Het
Kcnj11 A T 7: 46,098,808 S364T probably benign Het
Lnpep A T 17: 17,579,182 Y70* probably null Het
Mark1 T C 1: 184,944,816 H79R probably damaging Het
Myo9b T G 8: 71,290,372 S26A probably benign Het
Pa2g4 G T 10: 128,559,457 N306K probably benign Het
Pik3c3 T A 18: 30,277,113 Y133* probably null Het
Prpf6 G T 2: 181,649,140 A675S probably damaging Het
Psca A G 15: 74,716,099 D44G probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Scn10a A G 9: 119,624,136 L1231P probably damaging Het
Sirpa T C 2: 129,616,252 S157P probably benign Het
Slc27a2 A T 2: 126,561,610 R184S probably benign Het
Tagln2 T C 1: 172,505,912 F111S probably damaging Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Togaram2 G A 17: 71,689,209 R68K probably benign Het
Trim40 A T 17: 36,888,982 I68N probably damaging Het
Trpa1 T C 1: 14,875,854 M1018V probably benign Het
Unc13c A T 9: 73,932,602 N322K probably damaging Het
Vmn2r75 T A 7: 86,171,571 T52S probably benign Het
Vmn2r90 T G 17: 17,726,772 V437G possibly damaging Het
Vps16 C A 2: 130,440,324 H389N possibly damaging Het
Other mutations in Tert
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Tert APN 13 73628297 missense possibly damaging 0.76
IGL01585:Tert APN 13 73634344 missense probably benign 0.15
IGL03167:Tert APN 13 73640000 missense probably damaging 1.00
galileo UTSW 13 73627606 missense probably damaging 1.00
FR4304:Tert UTSW 13 73648302 utr 3 prime probably benign
FR4342:Tert UTSW 13 73648300 utr 3 prime probably benign
FR4589:Tert UTSW 13 73648304 utr 3 prime probably benign
PIT4377001:Tert UTSW 13 73628261 missense possibly damaging 0.54
R0372:Tert UTSW 13 73648991 missense probably damaging 1.00
R0433:Tert UTSW 13 73627081 missense probably damaging 1.00
R0829:Tert UTSW 13 73644385 missense probably damaging 1.00
R1023:Tert UTSW 13 73642059 missense probably benign 0.41
R1236:Tert UTSW 13 73636379 missense probably damaging 0.99
R1331:Tert UTSW 13 73648354 missense probably damaging 1.00
R1426:Tert UTSW 13 73642353 splice site probably benign
R1467:Tert UTSW 13 73628209 missense probably benign 0.10
R1467:Tert UTSW 13 73628209 missense probably benign 0.10
R1521:Tert UTSW 13 73642056 missense probably damaging 1.00
R2484:Tert UTSW 13 73647985 missense probably benign
R3162:Tert UTSW 13 73627409 missense possibly damaging 0.45
R3162:Tert UTSW 13 73627409 missense possibly damaging 0.45
R4428:Tert UTSW 13 73627475 missense probably damaging 1.00
R4430:Tert UTSW 13 73627475 missense probably damaging 1.00
R4431:Tert UTSW 13 73627475 missense probably damaging 1.00
R4630:Tert UTSW 13 73648991 missense probably damaging 1.00
R4696:Tert UTSW 13 73627820 missense probably benign 0.25
R4751:Tert UTSW 13 73628063 missense possibly damaging 0.89
R4926:Tert UTSW 13 73648389 missense possibly damaging 0.62
R5011:Tert UTSW 13 73646309 critical splice donor site probably null
R5013:Tert UTSW 13 73646309 critical splice donor site probably null
R5061:Tert UTSW 13 73634278 missense probably damaging 1.00
R5268:Tert UTSW 13 73627354 missense probably damaging 1.00
R5323:Tert UTSW 13 73648371 missense probably benign 0.07
R5396:Tert UTSW 13 73639243 missense probably damaging 0.97
R5445:Tert UTSW 13 73644284 missense probably benign 0.00
R5688:Tert UTSW 13 73639156 missense probably damaging 1.00
R6092:Tert UTSW 13 73628581 missense probably benign 0.34
R6973:Tert UTSW 13 73627988 missense probably benign 0.02
R7069:Tert UTSW 13 73628410 missense probably damaging 0.99
R7317:Tert UTSW 13 73642376 missense probably damaging 1.00
R7747:Tert UTSW 13 73627606 missense probably damaging 1.00
R7787:Tert UTSW 13 73648932 missense probably damaging 0.99
R7846:Tert UTSW 13 73628195 missense probably damaging 1.00
R7994:Tert UTSW 13 73648955 missense probably benign 0.20
R8042:Tert UTSW 13 73627145 missense probably damaging 1.00
R8044:Tert UTSW 13 73635449 missense probably damaging 1.00
R8867:Tert UTSW 13 73628447 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGCCTTCGCTTCATGAAAAGC -3'
(R):5'- TTGGTGACCATATGAGCCCC -3'

Sequencing Primer
(F):5'- CTTCATGAAAAGCTGTGAAGCATCC -3'
(R):5'- CTAACCAGTTAAATATGCTGCCTTAG -3'
Posted On2016-11-09