Incidental Mutation 'R5680:3425401B19Rik'
ID442995
Institutional Source Beutler Lab
Gene Symbol 3425401B19Rik
Ensembl Gene ENSMUSG00000071540
Gene NameRIKEN cDNA 3425401B19 gene
Synonyms
MMRRC Submission 043177-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R5680 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32659119-32685293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32662053 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 652 (R652W)
Ref Sequence ENSEMBL: ENSMUSP00000093741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096038]
Predicted Effect probably damaging
Transcript: ENSMUST00000096038
AA Change: R652W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: R652W

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
low complexity region 605 624 N/A INTRINSIC
low complexity region 728 744 N/A INTRINSIC
low complexity region 1002 1015 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1147 1158 N/A INTRINSIC
low complexity region 1161 1176 N/A INTRINSIC
Pfam:DUF4585 1251 1322 6.5e-30 PFAM
Meta Mutation Damage Score 0.2548 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,236,645 F362S possibly damaging Het
Adcy1 G A 11: 7,109,020 V309M probably damaging Het
Agap2 A G 10: 127,088,011 K752E unknown Het
Ahdc1 T A 4: 133,065,596 F1383I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Atn1 A T 6: 124,747,815 S152T possibly damaging Het
Bcl11a G A 11: 24,164,264 V536M possibly damaging Het
Cdc20 T C 4: 118,433,067 T466A probably damaging Het
Cecr2 C G 6: 120,761,426 T1010R probably benign Het
Cfap54 A T 10: 92,979,017 L1318* probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Dnah6 A G 6: 73,149,525 V1273A probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
G3bp2 T C 5: 92,068,360 R106G probably damaging Het
Ggt7 A T 2: 155,506,433 C100S probably damaging Het
Gm765 T A 6: 98,248,226 Q32L probably damaging Het
Grik4 A T 9: 42,629,119 M255K probably benign Het
Kcnj11 A T 7: 46,098,808 S364T probably benign Het
Lnpep A T 17: 17,579,182 Y70* probably null Het
Mark1 T C 1: 184,944,816 H79R probably damaging Het
Myo9b T G 8: 71,290,372 S26A probably benign Het
Pa2g4 G T 10: 128,559,457 N306K probably benign Het
Pik3c3 T A 18: 30,277,113 Y133* probably null Het
Prpf6 G T 2: 181,649,140 A675S probably damaging Het
Psca A G 15: 74,716,099 D44G probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Scn10a A G 9: 119,624,136 L1231P probably damaging Het
Sirpa T C 2: 129,616,252 S157P probably benign Het
Slc27a2 A T 2: 126,561,610 R184S probably benign Het
Tagln2 T C 1: 172,505,912 F111S probably damaging Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tert T A 13: 73,642,351 probably null Het
Togaram2 G A 17: 71,689,209 R68K probably benign Het
Trim40 A T 17: 36,888,982 I68N probably damaging Het
Trpa1 T C 1: 14,875,854 M1018V probably benign Het
Unc13c A T 9: 73,932,602 N322K probably damaging Het
Vmn2r75 T A 7: 86,171,571 T52S probably benign Het
Vmn2r90 T G 17: 17,726,772 V437G possibly damaging Het
Vps16 C A 2: 130,440,324 H389N possibly damaging Het
Other mutations in 3425401B19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:3425401B19Rik APN 14 32660916 missense probably benign 0.18
IGL00844:3425401B19Rik APN 14 32662999 nonsense probably null
IGL01292:3425401B19Rik APN 14 32660874 missense probably benign 0.18
IGL01295:3425401B19Rik APN 14 32661936 missense possibly damaging 0.53
IGL01457:3425401B19Rik APN 14 32660951 missense probably benign
IGL01470:3425401B19Rik APN 14 32660457 missense possibly damaging 0.53
IGL01612:3425401B19Rik APN 14 32660031 missense possibly damaging 0.53
IGL01974:3425401B19Rik APN 14 32659805 missense possibly damaging 0.85
IGL02095:3425401B19Rik APN 14 32661626 missense probably benign 0.33
IGL02138:3425401B19Rik APN 14 32662715 missense possibly damaging 0.83
IGL02178:3425401B19Rik APN 14 32662461 missense possibly damaging 0.83
IGL02245:3425401B19Rik APN 14 32659815 missense probably benign 0.03
IGL02529:3425401B19Rik APN 14 32661233 missense probably benign
IGL03401:3425401B19Rik APN 14 32662266 nonsense probably null
PIT4515001:3425401B19Rik UTSW 14 32661111 nonsense probably null
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0320:3425401B19Rik UTSW 14 32662614 missense probably benign 0.19
R0519:3425401B19Rik UTSW 14 32662962 missense possibly damaging 0.92
R0551:3425401B19Rik UTSW 14 32662641 missense probably benign 0.03
R0759:3425401B19Rik UTSW 14 32662497 missense possibly damaging 0.93
R0831:3425401B19Rik UTSW 14 32662271 missense probably benign 0.01
R1124:3425401B19Rik UTSW 14 32662082 missense possibly damaging 0.53
R1346:3425401B19Rik UTSW 14 32660814 missense probably benign 0.07
R1997:3425401B19Rik UTSW 14 32660048 missense possibly damaging 0.71
R2055:3425401B19Rik UTSW 14 32662551 missense probably benign
R2212:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R2416:3425401B19Rik UTSW 14 32663834 missense probably benign 0.04
R2441:3425401B19Rik UTSW 14 32663492 missense possibly damaging 0.53
R2513:3425401B19Rik UTSW 14 32661852 missense possibly damaging 0.53
R3414:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R3800:3425401B19Rik UTSW 14 32663068 missense possibly damaging 0.83
R3809:3425401B19Rik UTSW 14 32663693 missense possibly damaging 0.96
R4166:3425401B19Rik UTSW 14 32660955 missense possibly damaging 0.53
R4581:3425401B19Rik UTSW 14 32661871 missense possibly damaging 0.73
R4721:3425401B19Rik UTSW 14 32663150 missense probably benign 0.01
R4769:3425401B19Rik UTSW 14 32660217 missense probably benign 0.32
R4809:3425401B19Rik UTSW 14 32662631 missense probably benign 0.19
R4919:3425401B19Rik UTSW 14 32663288 missense possibly damaging 0.85
R4925:3425401B19Rik UTSW 14 32663180 missense possibly damaging 0.86
R4972:3425401B19Rik UTSW 14 32661404 missense possibly damaging 0.73
R5068:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5069:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5070:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5258:3425401B19Rik UTSW 14 32663309 missense probably damaging 0.98
R5435:3425401B19Rik UTSW 14 32661456 missense probably benign 0.18
R5549:3425401B19Rik UTSW 14 32663036 missense possibly damaging 0.68
R5678:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5872:3425401B19Rik UTSW 14 32660352 missense possibly damaging 0.73
R5896:3425401B19Rik UTSW 14 32661675 nonsense probably null
R5940:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6044:3425401B19Rik UTSW 14 32660657 missense possibly damaging 0.53
R6136:3425401B19Rik UTSW 14 32662282 missense possibly damaging 0.70
R6277:3425401B19Rik UTSW 14 32663694 missense possibly damaging 0.86
R6385:3425401B19Rik UTSW 14 32661279 missense probably benign 0.01
R6728:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6984:3425401B19Rik UTSW 14 32661980 missense probably benign 0.00
R7047:3425401B19Rik UTSW 14 32660174 missense possibly damaging 0.89
R7249:3425401B19Rik UTSW 14 32663314 missense possibly damaging 0.73
R7493:3425401B19Rik UTSW 14 32663300 missense possibly damaging 0.96
R7575:3425401B19Rik UTSW 14 32662632 missense probably benign 0.03
R7742:3425401B19Rik UTSW 14 32662757 missense possibly damaging 0.68
R7747:3425401B19Rik UTSW 14 32663069 missense possibly damaging 0.83
R7784:3425401B19Rik UTSW 14 32659840 missense probably benign 0.00
R8098:3425401B19Rik UTSW 14 32662661 missense probably damaging 0.99
R8111:3425401B19Rik UTSW 14 32660309 nonsense probably null
R8171:3425401B19Rik UTSW 14 32662025 missense probably benign
R8276:3425401B19Rik UTSW 14 32663928 missense probably damaging 0.97
R8330:3425401B19Rik UTSW 14 32659793 missense probably damaging 0.98
X0025:3425401B19Rik UTSW 14 32662469 missense probably damaging 0.98
Z1177:3425401B19Rik UTSW 14 32659808 missense possibly damaging 0.86
Z1177:3425401B19Rik UTSW 14 32661398 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGCTGTCGCTGTAAAACAC -3'
(R):5'- AATCCTTTGCAGTCAGCCAC -3'

Sequencing Primer
(F):5'- GCTGTCGCTGTAAAACACATCCTC -3'
(R):5'- GACCTTCAGTTCACCTTCAGCTAG -3'
Posted On2016-11-09