Incidental Mutation 'R5680:Trim40'
ID 442998
Institutional Source Beutler Lab
Gene Symbol Trim40
Ensembl Gene ENSMUSG00000073399
Gene Name tripartite motif-containing 40
Synonyms LOC195359, LOC240093, LOC333872
MMRRC Submission 043177-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R5680 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 36881598-36890123 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36888982 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 68 (I68N)
Ref Sequence ENSEMBL: ENSMUSP00000084400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087158] [ENSMUST00000172711]
AlphaFold Q3UWA4
Predicted Effect probably damaging
Transcript: ENSMUST00000087158
AA Change: I68N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084400
Gene: ENSMUSG00000073399
AA Change: I68N

DomainStartEndE-ValueType
RING 12 54 6e-8 SMART
Pfam:zf-B_box 65 105 1.1e-6 PFAM
coiled coil region 106 150 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172640
Predicted Effect probably damaging
Transcript: ENSMUST00000172711
AA Change: I68N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133581
Gene: ENSMUSG00000073399
AA Change: I68N

DomainStartEndE-ValueType
RING 12 54 6e-8 SMART
Pfam:zf-B_box 65 105 3.4e-7 PFAM
coiled coil region 106 150 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174107
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) protein family. The encoded protein may play a role as a negative regulator against inflammation and carcinogenesis in the gastrointestinal tract. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
Abca6 A G 11: 110,236,645 F362S possibly damaging Het
Adcy1 G A 11: 7,109,020 V309M probably damaging Het
Agap2 A G 10: 127,088,011 K752E unknown Het
Ahdc1 T A 4: 133,065,596 F1383I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Atn1 A T 6: 124,747,815 S152T possibly damaging Het
Bcl11a G A 11: 24,164,264 V536M possibly damaging Het
Cdc20 T C 4: 118,433,067 T466A probably damaging Het
Cecr2 C G 6: 120,761,426 T1010R probably benign Het
Cfap54 A T 10: 92,979,017 L1318* probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Dnah6 A G 6: 73,149,525 V1273A probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
G3bp2 T C 5: 92,068,360 R106G probably damaging Het
Ggt7 A T 2: 155,506,433 C100S probably damaging Het
Gm765 T A 6: 98,248,226 Q32L probably damaging Het
Grik4 A T 9: 42,629,119 M255K probably benign Het
Kcnj11 A T 7: 46,098,808 S364T probably benign Het
Lnpep A T 17: 17,579,182 Y70* probably null Het
Mark1 T C 1: 184,944,816 H79R probably damaging Het
Myo9b T G 8: 71,290,372 S26A probably benign Het
Pa2g4 G T 10: 128,559,457 N306K probably benign Het
Pik3c3 T A 18: 30,277,113 Y133* probably null Het
Prpf6 G T 2: 181,649,140 A675S probably damaging Het
Psca A G 15: 74,716,099 D44G probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Scn10a A G 9: 119,624,136 L1231P probably damaging Het
Sirpa T C 2: 129,616,252 S157P probably benign Het
Slc27a2 A T 2: 126,561,610 R184S probably benign Het
Tagln2 T C 1: 172,505,912 F111S probably damaging Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tert T A 13: 73,642,351 probably null Het
Togaram2 G A 17: 71,689,209 R68K probably benign Het
Trpa1 T C 1: 14,875,854 M1018V probably benign Het
Unc13c A T 9: 73,932,602 N322K probably damaging Het
Vmn2r75 T A 7: 86,171,571 T52S probably benign Het
Vmn2r90 T G 17: 17,726,772 V437G possibly damaging Het
Vps16 C A 2: 130,440,324 H389N possibly damaging Het
Other mutations in Trim40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Trim40 APN 17 36882397 makesense probably null
IGL01085:Trim40 APN 17 36883241 missense probably benign 0.01
IGL02071:Trim40 APN 17 36889178 missense probably benign
IGL02343:Trim40 APN 17 36889138 missense probably benign 0.03
R0116:Trim40 UTSW 17 36883147 critical splice donor site probably null
R1853:Trim40 UTSW 17 36889078 missense probably damaging 1.00
R2216:Trim40 UTSW 17 36888983 missense probably benign 0.10
R4649:Trim40 UTSW 17 36882639 splice site probably null
R4903:Trim40 UTSW 17 36883225 missense possibly damaging 0.95
R5384:Trim40 UTSW 17 36888865 missense probably damaging 0.99
R5969:Trim40 UTSW 17 36882427 missense probably benign
R6830:Trim40 UTSW 17 36888850 missense possibly damaging 0.89
R7008:Trim40 UTSW 17 36883976 missense probably damaging 1.00
R7112:Trim40 UTSW 17 36882642 missense probably null 1.00
R7283:Trim40 UTSW 17 36882662 missense probably benign 0.05
R8288:Trim40 UTSW 17 36883318 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTACCAAGCCTCTGTGAGGATC -3'
(R):5'- TGGGCTCTCTTGACAAGGAC -3'

Sequencing Primer
(F):5'- CAAGCCTCTGTGAGGATCTGAAC -3'
(R):5'- AGGACAACCAGGACATTTGTC -3'
Posted On 2016-11-09