Mutagenetix > Incidental Mutations

Incidental Mutation 'R5681:Gm8251'

443002

Institutional Source

Beutler Lab

Gene Symbol

Gm8251

Ensembl Gene

ENSMUSG00000091844

Gene Name

predicted gene 8251

Synonyms

Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R5681 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44055952-44061936 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 44061464 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 158 (V158D)

Ref Sequence

ENSEMBL: ENSMUSP00000127017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168641]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168641
AA Change: V158D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: V158D

Domain	Start	End	E-Value	Type
Pfam:CCDC168_N	2	202	2.5e-83	PFAM
Pfam:CCDC168_N	200	302	1.7e-26	PFAM
Pfam:CCDC168_N	347	397	2.1e-4	PFAM
Pfam:CCDC168_N	437	581	8.5e-8	PFAM
Pfam:CCDC168_N	663	802	6.3e-5	PFAM
Pfam:CCDC168_N	788	955	1e-9	PFAM
low complexity region	1803	1819	N/A	INTRINSIC
low complexity region	1830	1847	N/A	INTRINSIC
low complexity region	1968	1984	N/A	INTRINSIC

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 97.0%
20x: 94.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	T	A	5: 9,459,308		probably null	Het
Acoxl	T	C	2: 127,972,639	F45S	possibly damaging	Het
Adora2b	T	A	11: 62,249,241	V47E	probably damaging	Het
Amdhd2	A	G	17: 24,156,040	I396T	probably damaging	Het
Arhgap5	G	A	12: 52,519,779	D1178N	probably benign	Het
Atp10d	T	C	5: 72,246,946		probably benign	Het
Baiap3	A	G	17: 25,249,373	S264P	probably damaging	Het
BC055324	T	C	1: 163,962,085	N627S	probably damaging	Het
Brinp3	A	T	1: 146,901,746	I644F	probably benign	Het
Ccdc66	T	C	14: 27,486,741	R675G	probably benign	Het
Cnr2	T	G	4: 135,916,689	M26R	probably damaging	Het
Col6a2	A	T	10: 76,609,251		probably null	Het
Cux1	A	G	5: 136,308,184	W696R	probably damaging	Het
D6Ertd527e	A	G	6: 87,111,206	N117S	unknown	Het
Dnah12	T	C	14: 26,815,495	C2234R	probably benign	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Dock2	T	G	11: 34,249,836	I1405L	probably benign	Het
Dsg1c	T	C	18: 20,283,213	F724L	probably damaging	Het
Enoph1	T	C	5: 100,062,277		probably null	Het
Epha10	A	T	4: 124,902,566	Q356L	unknown	Het
Fbln2	G	T	6: 91,271,796	V1148L	probably damaging	Het
Gm11397	G	A	13: 33,395,829	C20Y	probably damaging	Het
Gp2	C	T	7: 119,452,294	V233M	possibly damaging	Het
Gtf2ird1	T	A	5: 134,363,318	S800C	probably damaging	Het
Hat1	A	G	2: 71,434,209		probably null	Het
Hpdl	A	T	4: 116,820,842	S141T	probably benign	Het
Klhl29	A	G	12: 5,090,669	S658P	possibly damaging	Het
Lifr	T	A	15: 7,191,084	I1065N	probably damaging	Het
Lrrn2	G	T	1: 132,937,161		probably benign	Het
March9	T	A	10: 127,058,303	I144F	probably benign	Het
Mtnr1a	A	G	8: 45,087,937	I312V	possibly damaging	Het
Ngf	T	A	3: 102,520,353	F139L	probably damaging	Het
Nipbl	T	C	15: 8,301,382	I2318V	probably benign	Het
Nkpd1	C	T	7: 19,523,573	Q276*	probably null	Het
Nphs1	A	G	7: 30,486,625	D1227G	probably benign	Het
Olfm3	C	A	3: 115,122,275	N285K	probably benign	Het
Olfr1313	T	A	2: 112,072,377	I69F	probably benign	Het
Olfr3	C	A	2: 36,812,681	S137I	probably benign	Het
Olfr855	G	A	9: 19,584,899	D121N	probably damaging	Het
Olfr870	A	G	9: 20,170,795	Y259H	probably damaging	Het
Olfr887	C	T	9: 38,085,631	S265F	possibly damaging	Het
Osbp2	A	G	11: 3,863,486	S128P	probably benign	Het
Otop2	A	T	11: 115,326,859	M174L	probably damaging	Het
Pard3	A	G	8: 127,389,433	T668A	possibly damaging	Het
Pkhd1	T	C	1: 20,547,461	T967A	possibly damaging	Het
Pls1	A	G	9: 95,787,012	V52A	probably damaging	Het
Ptcd3	T	C	6: 71,907,659	K64R	probably damaging	Het
Pxn	T	C	5: 115,544,534	W69R	possibly damaging	Het
Rai14	T	C	15: 10,575,120	D584G	probably damaging	Het
Safb	G	A	17: 56,599,000		probably benign	Het
Serinc2	A	C	4: 130,265,076	L10R	probably damaging	Het
Serpinb12	A	T	1: 106,946,701	H52L	probably benign	Het
Serpinf2	A	G	11: 75,435,939	Y273H	probably damaging	Het
Slc2a10	T	A	2: 165,514,740	S107T	probably benign	Het
Slc41a3	T	C	6: 90,640,946	L318P	probably damaging	Het
Slc6a3	A	T	13: 73,538,735	I74F	probably damaging	Het
Snrnp200	G	A	2: 127,225,135	G788D	probably damaging	Het
Snx7	A	G	3: 117,846,623	I79T	probably benign	Het
Sox11	G	T	12: 27,341,824	D195E	probably benign	Het
Ssc4d	A	G	5: 135,970,220	L43P	probably damaging	Het
Tab2	A	G	10: 7,920,073	I215T	probably damaging	Het
Ttn	C	T	2: 76,830,598	V7422I	possibly damaging	Het
Unc13c	A	T	9: 73,546,075		probably null	Het
Wdr17	T	C	8: 54,662,869	D633G	probably damaging	Het
Wdsub1	A	T	2: 59,852,895	M445K	probably damaging	Het
Xpc	A	G	6: 91,504,120	F257L	probably damaging	Het

Other mutations in Gm8251

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
D3080:Gm8251	UTSW	1	44067335
R0045:Gm8251	UTSW	1	44057205	missense	probably benign
R0110:Gm8251	UTSW	1	44059224	missense	probably benign
R0450:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0469:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0510:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0602:Gm8251	UTSW	1	44059967	missense	possibly damaging	0.96
R0648:Gm8251	UTSW	1	44056563	missense	possibly damaging	0.73
R0928:Gm8251	UTSW	1	44057228	missense	possibly damaging	0.73
R1056:Gm8251	UTSW	1	44060927	missense	probably damaging	1.00
R1217:Gm8251	UTSW	1	44057179	missense	possibly damaging	0.73
R1232:Gm8251	UTSW	1	44056592	missense	possibly damaging	0.96
R1399:Gm8251	UTSW	1	44061311	missense	possibly damaging	0.93
R1489:Gm8251	UTSW	1	44057790	missense	probably benign	0.18
R1489:Gm8251	UTSW	1	44061507	missense	probably benign	0.06
R1519:Gm8251	UTSW	1	44056970	missense	probably benign	0.33
R1664:Gm8251	UTSW	1	44059227	missense	possibly damaging	0.71
R1828:Gm8251	UTSW	1	44057074	missense	possibly damaging	0.72
R1944:Gm8251	UTSW	1	44061849	missense	probably damaging	0.97
R2032:Gm8251	UTSW	1	44061740	missense	possibly damaging	0.86
R2094:Gm8251	UTSW	1	44059730	missense	probably benign	0.06
R2170:Gm8251	UTSW	1	44056008	missense	probably benign	0.18
R2185:Gm8251	UTSW	1	44061381	missense	probably benign	0.01
R2280:Gm8251	UTSW	1	44056460	missense	possibly damaging	0.53
R2281:Gm8251	UTSW	1	44056460	missense	possibly damaging	0.53
R2339:Gm8251	UTSW	1	44060863	missense	probably benign
R3617:Gm8251	UTSW	1	44060954	missense	probably benign
R3738:Gm8251	UTSW	1	44058866	missense	probably benign	0.33
R4012:Gm8251	UTSW	1	44060969	missense	possibly damaging	0.85
R4034:Gm8251	UTSW	1	44058866	missense	probably benign	0.33
R4344:Gm8251	UTSW	1	44060991	missense	possibly damaging	0.86
R4436:Gm8251	UTSW	1	44056116	missense	probably benign	0.03
R4485:Gm8251	UTSW	1	44060123	missense	probably benign
R4735:Gm8251	UTSW	1	44061701	missense	probably benign
R4782:Gm8251	UTSW	1	44059043	missense	possibly damaging	0.85
R4837:Gm8251	UTSW	1	44061434	missense	possibly damaging	0.93
R4862:Gm8251	UTSW	1	44058018	missense	possibly damaging	0.93
R5247:Gm8251	UTSW	1	44057006	nonsense	probably null
R5347:Gm8251	UTSW	1	44057795	missense	probably benign	0.01
R5355:Gm8251	UTSW	1	44057979	missense	possibly damaging	0.53
R5559:Gm8251	UTSW	1	44058515	missense	possibly damaging	0.77
R5640:Gm8251	UTSW	1	44061927	missense	probably benign	0.00
R5776:Gm8251	UTSW	1	44056505	missense	possibly damaging	0.72
R5919:Gm8251	UTSW	1	44056986	missense	probably benign
R5987:Gm8251	UTSW	1	44057257	missense	probably benign
R6616:Gm8251	UTSW	1	44061474	missense	possibly damaging	0.51
R6677:Gm8251	UTSW	1	44058699	missense	probably benign	0.00
R6830:Gm8251	UTSW	1	44056730	missense	probably benign	0.33
R6906:Gm8251	UTSW	1	44056013	missense	probably benign	0.33
R6909:Gm8251	UTSW	1	44059775	missense	possibly damaging	0.71
R6957:Gm8251	UTSW	1	44057207	missense	probably benign	0.00
R7008:Gm8251	UTSW	1	44059625	missense	probably benign
R7052:Gm8251	UTSW	1	44057306	missense	possibly damaging	0.53
R7176:Gm8251	UTSW	1	44060346	missense	probably benign	0.00
R7190:Gm8251	UTSW	1	44061615	missense	probably benign	0.32
R7296:Gm8251	UTSW	1	44060916	nonsense	probably null
R7347:Gm8251	UTSW	1	44059496	missense	probably damaging	0.99
R7371:Gm8251	UTSW	1	44061377	missense	probably benign
R7375:Gm8251	UTSW	1	44060534	missense	possibly damaging	0.53
R7442:Gm8251	UTSW	1	44058708	missense	possibly damaging	0.84
R7450:Gm8251	UTSW	1	44058773	missense	probably benign	0.33
R7574:Gm8251	UTSW	1	44059433	missense	possibly damaging	0.93
R7586:Gm8251	UTSW	1	44060013	missense	probably benign	0.20
R7739:Gm8251	UTSW	1	44056418	missense	possibly damaging	0.86
R7878:Gm8251	UTSW	1	44056014	missense	probably benign	0.18
R7959:Gm8251	UTSW	1	44057568	missense	probably benign
R7991:Gm8251	UTSW	1	44059709	missense	probably benign	0.00
R8035:Gm8251	UTSW	1	44061551	missense	possibly damaging	0.51
R8281:Gm8251	UTSW	1	44056538	missense	possibly damaging	0.93
R8523:Gm8251	UTSW	1	44060834	missense	possibly damaging	0.86
YA93:Gm8251	UTSW	1	44065085	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- GTACTTCTTCCTGTACTGGGAG -3'
(R):5'- CAATGCAAAGCCATGTGCCC -3'

Sequencing Primer
(F):5'- CCTGTACTGGGAGAAGAATTTTTC -3'
(R):5'- GTGCTACAAAAACCATTGCCTGTAGG -3'

Posted On

2016-11-09