Mutagenetix > Incidental Mutations

Incidental Mutation 'R5681:Brinp3'

443005

Institutional Source

Beutler Lab

Gene Symbol

Brinp3

Ensembl Gene

ENSMUSG00000035131

Gene Name

bone morphogenetic protein/retinoic acid inducible neural specific 3

Synonyms

Fam5c, B830045N13Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.208) question?

Stock #

R5681 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

146494760-146902472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 146901746 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 644 (I644F)

Ref Sequence

ENSEMBL: ENSMUSP00000126074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000166814]

Predicted Effect

probably benign
Transcript: ENSMUST00000074622
AA Change: I644F

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: I644F

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128345

SMART Domains

Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166814
AA Change: I644F

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: I644F

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	T	A	5: 9,459,308		probably null	Het
Acoxl	T	C	2: 127,972,639	F45S	possibly damaging	Het
Adora2b	T	A	11: 62,249,241	V47E	probably damaging	Het
Amdhd2	A	G	17: 24,156,040	I396T	probably damaging	Het
Arhgap5	G	A	12: 52,519,779	D1178N	probably benign	Het
Atp10d	T	C	5: 72,246,946		probably benign	Het
Baiap3	A	G	17: 25,249,373	S264P	probably damaging	Het
BC055324	T	C	1: 163,962,085	N627S	probably damaging	Het
Ccdc66	T	C	14: 27,486,741	R675G	probably benign	Het
Cnr2	T	G	4: 135,916,689	M26R	probably damaging	Het
Col6a2	A	T	10: 76,609,251		probably null	Het
Cux1	A	G	5: 136,308,184	W696R	probably damaging	Het
D6Ertd527e	A	G	6: 87,111,206	N117S	unknown	Het
Dnah12	T	C	14: 26,815,495	C2234R	probably benign	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Dock2	T	G	11: 34,249,836	I1405L	probably benign	Het
Dsg1c	T	C	18: 20,283,213	F724L	probably damaging	Het
Enoph1	T	C	5: 100,062,277		probably null	Het
Epha10	A	T	4: 124,902,566	Q356L	unknown	Het
Fbln2	G	T	6: 91,271,796	V1148L	probably damaging	Het
Gm11397	G	A	13: 33,395,829	C20Y	probably damaging	Het
Gm8251	A	T	1: 44,061,464	V158D	possibly damaging	Het
Gp2	C	T	7: 119,452,294	V233M	possibly damaging	Het
Gtf2ird1	T	A	5: 134,363,318	S800C	probably damaging	Het
Hat1	A	G	2: 71,434,209		probably null	Het
Hpdl	A	T	4: 116,820,842	S141T	probably benign	Het
Klhl29	A	G	12: 5,090,669	S658P	possibly damaging	Het
Lifr	T	A	15: 7,191,084	I1065N	probably damaging	Het
Lrrn2	G	T	1: 132,937,161		probably benign	Het
March9	T	A	10: 127,058,303	I144F	probably benign	Het
Mtnr1a	A	G	8: 45,087,937	I312V	possibly damaging	Het
Ngf	T	A	3: 102,520,353	F139L	probably damaging	Het
Nipbl	T	C	15: 8,301,382	I2318V	probably benign	Het
Nkpd1	C	T	7: 19,523,573	Q276*	probably null	Het
Nphs1	A	G	7: 30,486,625	D1227G	probably benign	Het
Olfm3	C	A	3: 115,122,275	N285K	probably benign	Het
Olfr1313	T	A	2: 112,072,377	I69F	probably benign	Het
Olfr3	C	A	2: 36,812,681	S137I	probably benign	Het
Olfr855	G	A	9: 19,584,899	D121N	probably damaging	Het
Olfr870	A	G	9: 20,170,795	Y259H	probably damaging	Het
Olfr887	C	T	9: 38,085,631	S265F	possibly damaging	Het
Osbp2	A	G	11: 3,863,486	S128P	probably benign	Het
Otop2	A	T	11: 115,326,859	M174L	probably damaging	Het
Pard3	A	G	8: 127,389,433	T668A	possibly damaging	Het
Pkhd1	T	C	1: 20,547,461	T967A	possibly damaging	Het
Pls1	A	G	9: 95,787,012	V52A	probably damaging	Het
Ptcd3	T	C	6: 71,907,659	K64R	probably damaging	Het
Pxn	T	C	5: 115,544,534	W69R	possibly damaging	Het
Rai14	T	C	15: 10,575,120	D584G	probably damaging	Het
Safb	G	A	17: 56,599,000		probably benign	Het
Serinc2	A	C	4: 130,265,076	L10R	probably damaging	Het
Serpinb12	A	T	1: 106,946,701	H52L	probably benign	Het
Serpinf2	A	G	11: 75,435,939	Y273H	probably damaging	Het
Slc2a10	T	A	2: 165,514,740	S107T	probably benign	Het
Slc41a3	T	C	6: 90,640,946	L318P	probably damaging	Het
Slc6a3	A	T	13: 73,538,735	I74F	probably damaging	Het
Snrnp200	G	A	2: 127,225,135	G788D	probably damaging	Het
Snx7	A	G	3: 117,846,623	I79T	probably benign	Het
Sox11	G	T	12: 27,341,824	D195E	probably benign	Het
Ssc4d	A	G	5: 135,970,220	L43P	probably damaging	Het
Tab2	A	G	10: 7,920,073	I215T	probably damaging	Het
Ttn	C	T	2: 76,830,598	V7422I	possibly damaging	Het
Unc13c	A	T	9: 73,546,075		probably null	Het
Wdr17	T	C	8: 54,662,869	D633G	probably damaging	Het
Wdsub1	A	T	2: 59,852,895	M445K	probably damaging	Het
Xpc	A	G	6: 91,504,120	F257L	probably damaging	Het

Other mutations in Brinp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Brinp3	APN	1	146901774	missense	probably damaging	0.99
IGL00503:Brinp3	APN	1	146901167	missense	probably benign
IGL01702:Brinp3	APN	1	146751997	splice site	probably benign
IGL01728:Brinp3	APN	1	146831551	splice site	probably null
IGL01733:Brinp3	APN	1	146514803	missense	probably benign	0.33
IGL01937:Brinp3	APN	1	146901140	missense	probably benign
IGL02020:Brinp3	APN	1	146902127	utr 3 prime	probably benign
IGL02082:Brinp3	APN	1	146751862	missense	probably damaging	1.00
IGL02365:Brinp3	APN	1	146901122	missense	probably benign	0.00
IGL02366:Brinp3	APN	1	146701743	missense	possibly damaging	0.84
IGL02565:Brinp3	APN	1	146902032	missense	probably damaging	0.98
IGL02999:Brinp3	APN	1	146701849	splice site	probably null
IGL03099:Brinp3	APN	1	146902097	missense	possibly damaging	0.91
PIT4283001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
PIT4418001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0266:Brinp3	UTSW	1	146682680	nonsense	probably null
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1522:Brinp3	UTSW	1	146901890	missense	probably damaging	0.99
R1596:Brinp3	UTSW	1	146514782	missense	probably benign
R1898:Brinp3	UTSW	1	146901249	missense	possibly damaging	0.93
R2036:Brinp3	UTSW	1	146701841	missense	possibly damaging	0.84
R2224:Brinp3	UTSW	1	146901920	nonsense	probably null
R2272:Brinp3	UTSW	1	146901404	missense	possibly damaging	0.93
R2291:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R2322:Brinp3	UTSW	1	146701754	missense	probably benign
R2880:Brinp3	UTSW	1	146902002	missense	probably damaging	0.98
R3918:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3939:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3940:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3941:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3942:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R4095:Brinp3	UTSW	1	146901692	missense	possibly damaging	0.72
R4783:Brinp3	UTSW	1	146727640	intron	probably benign
R5009:Brinp3	UTSW	1	146901049	missense	probably benign	0.25
R5034:Brinp3	UTSW	1	146727720	intron	probably benign
R5166:Brinp3	UTSW	1	146901367	missense	probably damaging	0.96
R5372:Brinp3	UTSW	1	146831726	missense	probably damaging	1.00
R5472:Brinp3	UTSW	1	146901459	missense	possibly damaging	0.86
R5651:Brinp3	UTSW	1	146701799	missense	probably benign	0.01
R6351:Brinp3	UTSW	1	146901585	missense	probably damaging	0.96
R6470:Brinp3	UTSW	1	146901906	missense	probably damaging	0.99
R6499:Brinp3	UTSW	1	146901693	missense	possibly damaging	0.86
R7078:Brinp3	UTSW	1	146514889	nonsense	probably null
R7223:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R7322:Brinp3	UTSW	1	146682688	nonsense	probably null
R7347:Brinp3	UTSW	1	146902086	missense	probably benign	0.22
R7375:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7412:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7532:Brinp3	UTSW	1	146901401	missense	probably damaging	0.98
R7562:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7576:Brinp3	UTSW	1	146901563	missense	probably damaging	0.99
R7723:Brinp3	UTSW	1	146701671	missense	probably damaging	1.00
R7737:Brinp3	UTSW	1	146682594	missense	probably damaging	0.98
R7793:Brinp3	UTSW	1	146746568	missense	probably benign	0.20
R8334:Brinp3	UTSW	1	146902053	missense	probably damaging	0.99
R8401:Brinp3	UTSW	1	146901446	missense	probably benign	0.17
X0060:Brinp3	UTSW	1	146901786	missense	probably benign	0.01
Z1176:Brinp3	UTSW	1	146902076	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CGAGAGCTGGTTTATGCCTG -3'
(R):5'- GGGAGAGTTTATTTACACGGTCTC -3'

Sequencing Primer
(F):5'- CTGTGAGTGAGAGCAGCTTTCC -3'
(R):5'- CTTATCTCTAGTAGCTGCAAAAGTG -3'

Posted On

2016-11-09