Incidental Mutation 'R5681:Serpinf2'
ID443057
Institutional Source Beutler Lab
Gene Symbol Serpinf2
Ensembl Gene ENSMUSG00000038224
Gene Nameserine (or cysteine) peptidase inhibitor, clade F, member 2
Synonymsalpha 2 antiplasmin, Pli
Accession Numbers

Genbank: NM_008878; MGI: 107173

Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R5681 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location75431732-75439591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75435939 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 273 (Y273H)
Ref Sequence ENSEMBL: ENSMUSP00000114450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043696] [ENSMUST00000108437] [ENSMUST00000128330] [ENSMUST00000142094]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043696
AA Change: Y273H

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048704
Gene: ENSMUSG00000038224
AA Change: Y273H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 91 436 1.5e-137 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108437
AA Change: Y273H

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104076
Gene: ENSMUSG00000038224
AA Change: Y273H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 91 436 1.5e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128330
AA Change: Y273H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114450
Gene: ENSMUSG00000038224
AA Change: Y273H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 91 280 1.07e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142094
SMART Domains Protein: ENSMUSP00000120812
Gene: ENSMUSG00000038224

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin family of serine protease inhibitors. The protein is a major inhibitor of plasmin, which degrades fibrin and various other proteins. Consequently, the proper function of this gene has a major role in regulating the blood clotting pathway. Mutations in this gene result in alpha-2-plasmin inhibitor deficiency, which is characterized by severe hemorrhagic diathesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have an essentially normal phenotype. Spontaneous lysis of blood clots occurs more readily but bleeding times are unaffected. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,459,308 probably null Het
Acoxl T C 2: 127,972,639 F45S possibly damaging Het
Adora2b T A 11: 62,249,241 V47E probably damaging Het
Amdhd2 A G 17: 24,156,040 I396T probably damaging Het
Arhgap5 G A 12: 52,519,779 D1178N probably benign Het
Atp10d T C 5: 72,246,946 probably benign Het
Baiap3 A G 17: 25,249,373 S264P probably damaging Het
BC055324 T C 1: 163,962,085 N627S probably damaging Het
Brinp3 A T 1: 146,901,746 I644F probably benign Het
Ccdc66 T C 14: 27,486,741 R675G probably benign Het
Cnr2 T G 4: 135,916,689 M26R probably damaging Het
Col6a2 A T 10: 76,609,251 probably null Het
Cux1 A G 5: 136,308,184 W696R probably damaging Het
D6Ertd527e A G 6: 87,111,206 N117S unknown Het
Dnah12 T C 14: 26,815,495 C2234R probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock2 T G 11: 34,249,836 I1405L probably benign Het
Dsg1c T C 18: 20,283,213 F724L probably damaging Het
Enoph1 T C 5: 100,062,277 probably null Het
Epha10 A T 4: 124,902,566 Q356L unknown Het
Fbln2 G T 6: 91,271,796 V1148L probably damaging Het
Gm11397 G A 13: 33,395,829 C20Y probably damaging Het
Gm8251 A T 1: 44,061,464 V158D possibly damaging Het
Gp2 C T 7: 119,452,294 V233M possibly damaging Het
Gtf2ird1 T A 5: 134,363,318 S800C probably damaging Het
Hat1 A G 2: 71,434,209 probably null Het
Hpdl A T 4: 116,820,842 S141T probably benign Het
Klhl29 A G 12: 5,090,669 S658P possibly damaging Het
Lifr T A 15: 7,191,084 I1065N probably damaging Het
Lrrn2 G T 1: 132,937,161 probably benign Het
March9 T A 10: 127,058,303 I144F probably benign Het
Mtnr1a A G 8: 45,087,937 I312V possibly damaging Het
Ngf T A 3: 102,520,353 F139L probably damaging Het
Nipbl T C 15: 8,301,382 I2318V probably benign Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nphs1 A G 7: 30,486,625 D1227G probably benign Het
Olfm3 C A 3: 115,122,275 N285K probably benign Het
Olfr1313 T A 2: 112,072,377 I69F probably benign Het
Olfr3 C A 2: 36,812,681 S137I probably benign Het
Olfr855 G A 9: 19,584,899 D121N probably damaging Het
Olfr870 A G 9: 20,170,795 Y259H probably damaging Het
Olfr887 C T 9: 38,085,631 S265F possibly damaging Het
Osbp2 A G 11: 3,863,486 S128P probably benign Het
Otop2 A T 11: 115,326,859 M174L probably damaging Het
Pard3 A G 8: 127,389,433 T668A possibly damaging Het
Pkhd1 T C 1: 20,547,461 T967A possibly damaging Het
Pls1 A G 9: 95,787,012 V52A probably damaging Het
Ptcd3 T C 6: 71,907,659 K64R probably damaging Het
Pxn T C 5: 115,544,534 W69R possibly damaging Het
Rai14 T C 15: 10,575,120 D584G probably damaging Het
Safb G A 17: 56,599,000 probably benign Het
Serinc2 A C 4: 130,265,076 L10R probably damaging Het
Serpinb12 A T 1: 106,946,701 H52L probably benign Het
Slc2a10 T A 2: 165,514,740 S107T probably benign Het
Slc41a3 T C 6: 90,640,946 L318P probably damaging Het
Slc6a3 A T 13: 73,538,735 I74F probably damaging Het
Snrnp200 G A 2: 127,225,135 G788D probably damaging Het
Snx7 A G 3: 117,846,623 I79T probably benign Het
Sox11 G T 12: 27,341,824 D195E probably benign Het
Ssc4d A G 5: 135,970,220 L43P probably damaging Het
Tab2 A G 10: 7,920,073 I215T probably damaging Het
Ttn C T 2: 76,830,598 V7422I possibly damaging Het
Unc13c A T 9: 73,546,075 probably null Het
Wdr17 T C 8: 54,662,869 D633G probably damaging Het
Wdsub1 A T 2: 59,852,895 M445K probably damaging Het
Xpc A G 6: 91,504,120 F257L probably damaging Het
Other mutations in Serpinf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Serpinf2 APN 11 75436507 missense possibly damaging 0.58
IGL01367:Serpinf2 APN 11 75438045 missense probably benign
IGL01382:Serpinf2 APN 11 75438037 unclassified probably benign
R0122:Serpinf2 UTSW 11 75436546 missense probably damaging 1.00
R0135:Serpinf2 UTSW 11 75436393 missense probably damaging 1.00
R1864:Serpinf2 UTSW 11 75437483 missense possibly damaging 0.74
R2202:Serpinf2 UTSW 11 75436762 missense probably benign 0.07
R3082:Serpinf2 UTSW 11 75437528 missense probably benign 0.19
R5117:Serpinf2 UTSW 11 75432500 missense probably benign 0.28
R5487:Serpinf2 UTSW 11 75433205 missense probably damaging 0.99
R5764:Serpinf2 UTSW 11 75437404 missense possibly damaging 0.94
R5868:Serpinf2 UTSW 11 75433239 missense probably benign 0.00
R6349:Serpinf2 UTSW 11 75432431 missense probably damaging 1.00
R6364:Serpinf2 UTSW 11 75436489 missense probably damaging 1.00
R6488:Serpinf2 UTSW 11 75437503 missense probably benign
R6701:Serpinf2 UTSW 11 75432443 missense probably damaging 0.97
R7034:Serpinf2 UTSW 11 75438418 unclassified probably benign
R7036:Serpinf2 UTSW 11 75438418 unclassified probably benign
YA93:Serpinf2 UTSW 11 75432684 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCAAAGAAGCTGTGTCCTG -3'
(R):5'- AAGACCAGCTAGATGTCAACCG -3'

Sequencing Primer
(F):5'- TGTGTCCTGGATAGACACAGC -3'
(R):5'- AGCTAGATGTCAACCGGCCAG -3'
Posted On2016-11-09