Incidental Mutation 'R5681:Otop2'
ID443058
Institutional Source Beutler Lab
Gene Symbol Otop2
Ensembl Gene ENSMUSG00000050201
Gene Nameotopetrin 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5681 (G1)
Quality Score211
Status Not validated
Chromosome11
Chromosomal Location115307163-115332303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115326859 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 174 (M174L)
Ref Sequence ENSEMBL: ENSMUSP00000102154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055490] [ENSMUST00000103037] [ENSMUST00000106544]
Predicted Effect probably damaging
Transcript: ENSMUST00000055490
AA Change: M174L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062109
Gene: ENSMUSG00000050201
AA Change: M174L

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 62 81 N/A INTRINSIC
Pfam:Otopetrin 102 225 1e-18 PFAM
Pfam:Otopetrin 214 451 5.5e-20 PFAM
Pfam:Otopetrin 479 550 8.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103037
SMART Domains Protein: ENSMUSP00000099326
Gene: ENSMUSG00000045288

DomainStartEndE-ValueType
ANK 31 60 1.83e-3 SMART
ANK 64 93 8.07e-5 SMART
ANK 97 126 6.26e-2 SMART
low complexity region 159 190 N/A INTRINSIC
PDB:3PVL|B 295 368 3e-30 PDB
SAM 385 449 1.34e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106544
AA Change: M174L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102154
Gene: ENSMUSG00000050201
AA Change: M174L

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 62 81 N/A INTRINSIC
Pfam:Otopetrin 102 450 7.9e-54 PFAM
Pfam:Otopetrin 476 550 2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139466
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,459,308 probably null Het
Acoxl T C 2: 127,972,639 F45S possibly damaging Het
Adora2b T A 11: 62,249,241 V47E probably damaging Het
Amdhd2 A G 17: 24,156,040 I396T probably damaging Het
Arhgap5 G A 12: 52,519,779 D1178N probably benign Het
Atp10d T C 5: 72,246,946 probably benign Het
Baiap3 A G 17: 25,249,373 S264P probably damaging Het
BC055324 T C 1: 163,962,085 N627S probably damaging Het
Brinp3 A T 1: 146,901,746 I644F probably benign Het
Ccdc66 T C 14: 27,486,741 R675G probably benign Het
Cnr2 T G 4: 135,916,689 M26R probably damaging Het
Col6a2 A T 10: 76,609,251 probably null Het
Cux1 A G 5: 136,308,184 W696R probably damaging Het
D6Ertd527e A G 6: 87,111,206 N117S unknown Het
Dnah12 T C 14: 26,815,495 C2234R probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock2 T G 11: 34,249,836 I1405L probably benign Het
Dsg1c T C 18: 20,283,213 F724L probably damaging Het
Enoph1 T C 5: 100,062,277 probably null Het
Epha10 A T 4: 124,902,566 Q356L unknown Het
Fbln2 G T 6: 91,271,796 V1148L probably damaging Het
Gm11397 G A 13: 33,395,829 C20Y probably damaging Het
Gm8251 A T 1: 44,061,464 V158D possibly damaging Het
Gp2 C T 7: 119,452,294 V233M possibly damaging Het
Gtf2ird1 T A 5: 134,363,318 S800C probably damaging Het
Hat1 A G 2: 71,434,209 probably null Het
Hpdl A T 4: 116,820,842 S141T probably benign Het
Klhl29 A G 12: 5,090,669 S658P possibly damaging Het
Lifr T A 15: 7,191,084 I1065N probably damaging Het
Lrrn2 G T 1: 132,937,161 probably benign Het
March9 T A 10: 127,058,303 I144F probably benign Het
Mtnr1a A G 8: 45,087,937 I312V possibly damaging Het
Ngf T A 3: 102,520,353 F139L probably damaging Het
Nipbl T C 15: 8,301,382 I2318V probably benign Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nphs1 A G 7: 30,486,625 D1227G probably benign Het
Olfm3 C A 3: 115,122,275 N285K probably benign Het
Olfr1313 T A 2: 112,072,377 I69F probably benign Het
Olfr3 C A 2: 36,812,681 S137I probably benign Het
Olfr855 G A 9: 19,584,899 D121N probably damaging Het
Olfr870 A G 9: 20,170,795 Y259H probably damaging Het
Olfr887 C T 9: 38,085,631 S265F possibly damaging Het
Osbp2 A G 11: 3,863,486 S128P probably benign Het
Pard3 A G 8: 127,389,433 T668A possibly damaging Het
Pkhd1 T C 1: 20,547,461 T967A possibly damaging Het
Pls1 A G 9: 95,787,012 V52A probably damaging Het
Ptcd3 T C 6: 71,907,659 K64R probably damaging Het
Pxn T C 5: 115,544,534 W69R possibly damaging Het
Rai14 T C 15: 10,575,120 D584G probably damaging Het
Safb G A 17: 56,599,000 probably benign Het
Serinc2 A C 4: 130,265,076 L10R probably damaging Het
Serpinb12 A T 1: 106,946,701 H52L probably benign Het
Serpinf2 A G 11: 75,435,939 Y273H probably damaging Het
Slc2a10 T A 2: 165,514,740 S107T probably benign Het
Slc41a3 T C 6: 90,640,946 L318P probably damaging Het
Slc6a3 A T 13: 73,538,735 I74F probably damaging Het
Snrnp200 G A 2: 127,225,135 G788D probably damaging Het
Snx7 A G 3: 117,846,623 I79T probably benign Het
Sox11 G T 12: 27,341,824 D195E probably benign Het
Ssc4d A G 5: 135,970,220 L43P probably damaging Het
Tab2 A G 10: 7,920,073 I215T probably damaging Het
Ttn C T 2: 76,830,598 V7422I possibly damaging Het
Unc13c A T 9: 73,546,075 probably null Het
Wdr17 T C 8: 54,662,869 D633G probably damaging Het
Wdsub1 A T 2: 59,852,895 M445K probably damaging Het
Xpc A G 6: 91,504,120 F257L probably damaging Het
Other mutations in Otop2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Otop2 APN 11 115331909 missense probably damaging 1.00
IGL01832:Otop2 APN 11 115326943 missense probably benign
IGL02114:Otop2 APN 11 115326980 missense possibly damaging 0.64
IGL02432:Otop2 APN 11 115329162 missense probably damaging 0.99
IGL02453:Otop2 APN 11 115324629 nonsense probably null
IGL02986:Otop2 APN 11 115329567 missense probably benign 0.11
IGL03225:Otop2 APN 11 115329807 missense probably damaging 1.00
R0402:Otop2 UTSW 11 115326408 splice site probably benign
R0553:Otop2 UTSW 11 115329462 missense probably damaging 0.98
R1209:Otop2 UTSW 11 115324643 missense possibly damaging 0.70
R1497:Otop2 UTSW 11 115329849 unclassified probably null
R1765:Otop2 UTSW 11 115324678 missense probably benign 0.04
R1822:Otop2 UTSW 11 115324628 missense probably benign 0.41
R1926:Otop2 UTSW 11 115326955 missense probably benign 0.00
R2151:Otop2 UTSW 11 115329411 missense possibly damaging 0.90
R2192:Otop2 UTSW 11 115326931 missense possibly damaging 0.63
R2350:Otop2 UTSW 11 115326850 missense probably damaging 0.97
R2352:Otop2 UTSW 11 115329101 missense probably damaging 1.00
R2915:Otop2 UTSW 11 115329146 missense probably benign 0.07
R3614:Otop2 UTSW 11 115329146 missense probably benign 0.07
R4060:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4061:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4062:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4063:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4064:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4184:Otop2 UTSW 11 115329845 missense probably benign 0.05
R4844:Otop2 UTSW 11 115323375 splice site probably null
R5713:Otop2 UTSW 11 115329044 missense probably damaging 0.98
R6738:Otop2 UTSW 11 115329492 missense probably damaging 1.00
R6975:Otop2 UTSW 11 115329326 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACTGGGCTGAGTCTTGCTTC -3'
(R):5'- CTGGCAAGGATATGGTTGACTGAC -3'

Sequencing Primer
(F):5'- GAGTCTTGCTTCCAAGTTCAACG -3'
(R):5'- TGACTGACTATGAATACACAAAGCG -3'
Posted On2016-11-09