Incidental Mutation 'R5681:Rai14'
ID443069
Institutional Source Beutler Lab
Gene Symbol Rai14
Ensembl Gene ENSMUSG00000022246
Gene Nameretinoic acid induced 14
Synonyms1700008J19Rik, 1700020L11Rik, Ankycorbin, Norpeg
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R5681 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location10568969-10714624 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10575120 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 584 (D584G)
Ref Sequence ENSEMBL: ENSMUSP00000153969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090339
AA Change: D613G

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246
AA Change: D613G

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000169385
AA Change: D613G

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246
AA Change: D613G

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000227506
AA Change: D584G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,459,308 probably null Het
Acoxl T C 2: 127,972,639 F45S possibly damaging Het
Adora2b T A 11: 62,249,241 V47E probably damaging Het
Amdhd2 A G 17: 24,156,040 I396T probably damaging Het
Arhgap5 G A 12: 52,519,779 D1178N probably benign Het
Atp10d T C 5: 72,246,946 probably benign Het
Baiap3 A G 17: 25,249,373 S264P probably damaging Het
BC055324 T C 1: 163,962,085 N627S probably damaging Het
Brinp3 A T 1: 146,901,746 I644F probably benign Het
Ccdc66 T C 14: 27,486,741 R675G probably benign Het
Cnr2 T G 4: 135,916,689 M26R probably damaging Het
Col6a2 A T 10: 76,609,251 probably null Het
Cux1 A G 5: 136,308,184 W696R probably damaging Het
D6Ertd527e A G 6: 87,111,206 N117S unknown Het
Dnah12 T C 14: 26,815,495 C2234R probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock2 T G 11: 34,249,836 I1405L probably benign Het
Dsg1c T C 18: 20,283,213 F724L probably damaging Het
Enoph1 T C 5: 100,062,277 probably null Het
Epha10 A T 4: 124,902,566 Q356L unknown Het
Fbln2 G T 6: 91,271,796 V1148L probably damaging Het
Gm11397 G A 13: 33,395,829 C20Y probably damaging Het
Gm8251 A T 1: 44,061,464 V158D possibly damaging Het
Gp2 C T 7: 119,452,294 V233M possibly damaging Het
Gtf2ird1 T A 5: 134,363,318 S800C probably damaging Het
Hat1 A G 2: 71,434,209 probably null Het
Hpdl A T 4: 116,820,842 S141T probably benign Het
Klhl29 A G 12: 5,090,669 S658P possibly damaging Het
Lifr T A 15: 7,191,084 I1065N probably damaging Het
Lrrn2 G T 1: 132,937,161 probably benign Het
March9 T A 10: 127,058,303 I144F probably benign Het
Mtnr1a A G 8: 45,087,937 I312V possibly damaging Het
Ngf T A 3: 102,520,353 F139L probably damaging Het
Nipbl T C 15: 8,301,382 I2318V probably benign Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nphs1 A G 7: 30,486,625 D1227G probably benign Het
Olfm3 C A 3: 115,122,275 N285K probably benign Het
Olfr1313 T A 2: 112,072,377 I69F probably benign Het
Olfr3 C A 2: 36,812,681 S137I probably benign Het
Olfr855 G A 9: 19,584,899 D121N probably damaging Het
Olfr870 A G 9: 20,170,795 Y259H probably damaging Het
Olfr887 C T 9: 38,085,631 S265F possibly damaging Het
Osbp2 A G 11: 3,863,486 S128P probably benign Het
Otop2 A T 11: 115,326,859 M174L probably damaging Het
Pard3 A G 8: 127,389,433 T668A possibly damaging Het
Pkhd1 T C 1: 20,547,461 T967A possibly damaging Het
Pls1 A G 9: 95,787,012 V52A probably damaging Het
Ptcd3 T C 6: 71,907,659 K64R probably damaging Het
Pxn T C 5: 115,544,534 W69R possibly damaging Het
Safb G A 17: 56,599,000 probably benign Het
Serinc2 A C 4: 130,265,076 L10R probably damaging Het
Serpinb12 A T 1: 106,946,701 H52L probably benign Het
Serpinf2 A G 11: 75,435,939 Y273H probably damaging Het
Slc2a10 T A 2: 165,514,740 S107T probably benign Het
Slc41a3 T C 6: 90,640,946 L318P probably damaging Het
Slc6a3 A T 13: 73,538,735 I74F probably damaging Het
Snrnp200 G A 2: 127,225,135 G788D probably damaging Het
Snx7 A G 3: 117,846,623 I79T probably benign Het
Sox11 G T 12: 27,341,824 D195E probably benign Het
Ssc4d A G 5: 135,970,220 L43P probably damaging Het
Tab2 A G 10: 7,920,073 I215T probably damaging Het
Ttn C T 2: 76,830,598 V7422I possibly damaging Het
Unc13c A T 9: 73,546,075 probably null Het
Wdr17 T C 8: 54,662,869 D633G probably damaging Het
Wdsub1 A T 2: 59,852,895 M445K probably damaging Het
Xpc A G 6: 91,504,120 F257L probably damaging Het
Other mutations in Rai14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rai14 APN 15 10599711 splice site probably benign
IGL01625:Rai14 APN 15 10572374 missense probably benign 0.30
IGL01925:Rai14 APN 15 10595862 missense possibly damaging 0.88
IGL02053:Rai14 APN 15 10633156 missense probably benign 0.00
IGL02531:Rai14 APN 15 10574782 missense probably damaging 1.00
IGL02748:Rai14 APN 15 10589335 missense probably benign 0.14
IGL02945:Rai14 APN 15 10574709 missense probably benign 0.00
PIT4618001:Rai14 UTSW 15 10575156 missense probably damaging 1.00
R1400:Rai14 UTSW 15 10571548 missense probably damaging 0.98
R1583:Rai14 UTSW 15 10587916 missense probably damaging 1.00
R1686:Rai14 UTSW 15 10592196 missense probably damaging 0.98
R1721:Rai14 UTSW 15 10633228 missense probably damaging 1.00
R1867:Rai14 UTSW 15 10633228 missense probably damaging 1.00
R1868:Rai14 UTSW 15 10633228 missense probably damaging 1.00
R1998:Rai14 UTSW 15 10594981 splice site probably null
R2118:Rai14 UTSW 15 10575166 missense probably benign 0.00
R3161:Rai14 UTSW 15 10633164 missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10633164 missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10633164 missense possibly damaging 0.74
R4049:Rai14 UTSW 15 10592212 missense probably benign 0.30
R4611:Rai14 UTSW 15 10592138 missense probably damaging 1.00
R4760:Rai14 UTSW 15 10575690 missense possibly damaging 0.60
R4863:Rai14 UTSW 15 10572470 missense probably damaging 0.99
R5022:Rai14 UTSW 15 10574506 missense probably damaging 0.96
R5110:Rai14 UTSW 15 10690410 start gained probably benign
R5410:Rai14 UTSW 15 10574938 missense probably damaging 1.00
R5643:Rai14 UTSW 15 10593051 missense probably benign 0.03
R5644:Rai14 UTSW 15 10593051 missense probably benign 0.03
R5934:Rai14 UTSW 15 10575159 missense probably damaging 0.98
R6333:Rai14 UTSW 15 10574936 nonsense probably null
R6338:Rai14 UTSW 15 10574976 missense probably damaging 1.00
R6864:Rai14 UTSW 15 10633168 missense possibly damaging 0.95
R7015:Rai14 UTSW 15 10589315 nonsense probably null
R7155:Rai14 UTSW 15 10595003 missense possibly damaging 0.53
R7480:Rai14 UTSW 15 10571536 missense probably benign 0.02
R7574:Rai14 UTSW 15 10593103 missense probably damaging 1.00
R7578:Rai14 UTSW 15 10574828 missense probably benign
R7578:Rai14 UTSW 15 10593103 missense probably damaging 1.00
R7597:Rai14 UTSW 15 10574851 missense possibly damaging 0.94
R7658:Rai14 UTSW 15 10593103 missense probably damaging 1.00
R7779:Rai14 UTSW 15 10593026 missense probably damaging 1.00
R7946:Rai14 UTSW 15 10574201 splice site probably null
R8171:Rai14 UTSW 15 10633163 missense probably damaging 1.00
R8195:Rai14 UTSW 15 10575216 missense probably benign
R8471:Rai14 UTSW 15 10575159 missense probably benign 0.01
R8485:Rai14 UTSW 15 10575036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACACGTGCATCAGCCTC -3'
(R):5'- GAGTTAGAGACTAAGCTTGCGG -3'

Sequencing Primer
(F):5'- TGAATGTACTCGGCTGCATC -3'
(R):5'- CTAAGCTTGCGGAGAAGGAGC -3'
Posted On2016-11-09