Incidental Mutation 'R5681:Rai14'
ID443069
Institutional Source Beutler Lab
Gene Symbol Rai14
Ensembl Gene ENSMUSG00000022246
Gene Nameretinoic acid induced 14
Synonyms1700008J19Rik, 1700020L11Rik, Ankycorbin, Norpeg
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.722) question?
Stock #R5681 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location10568969-10714624 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10575120 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 584 (D584G)
Ref Sequence ENSEMBL: ENSMUSP00000153969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090339
AA Change: D613G

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246
AA Change: D613G

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000169385
AA Change: D613G

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246
AA Change: D613G

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000227506
AA Change: D584G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,459,308 probably null Het
Acoxl T C 2: 127,972,639 F45S possibly damaging Het
Adora2b T A 11: 62,249,241 V47E probably damaging Het
Amdhd2 A G 17: 24,156,040 I396T probably damaging Het
Arhgap5 G A 12: 52,519,779 D1178N probably benign Het
Atp10d T C 5: 72,246,946 probably benign Het
Baiap3 A G 17: 25,249,373 S264P probably damaging Het
BC055324 T C 1: 163,962,085 N627S probably damaging Het
Brinp3 A T 1: 146,901,746 I644F probably benign Het
Ccdc66 T C 14: 27,486,741 R675G probably benign Het
Cnr2 T G 4: 135,916,689 M26R probably damaging Het
Col6a2 A T 10: 76,609,251 probably null Het
Cux1 A G 5: 136,308,184 W696R probably damaging Het
D6Ertd527e A G 6: 87,111,206 N117S unknown Het
Dnah12 T C 14: 26,815,495 C2234R probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock2 T G 11: 34,249,836 I1405L probably benign Het
Dsg1c T C 18: 20,283,213 F724L probably damaging Het
Enoph1 T C 5: 100,062,277 probably null Het
Epha10 A T 4: 124,902,566 Q356L unknown Het
Fbln2 G T 6: 91,271,796 V1148L probably damaging Het
Gm11397 G A 13: 33,395,829 C20Y probably damaging Het
Gm8251 A T 1: 44,061,464 V158D possibly damaging Het
Gp2 C T 7: 119,452,294 V233M possibly damaging Het
Gtf2ird1 T A 5: 134,363,318 S800C probably damaging Het
Hat1 A G 2: 71,434,209 probably null Het
Hpdl A T 4: 116,820,842 S141T probably benign Het
Klhl29 A G 12: 5,090,669 S658P possibly damaging Het
Lifr T A 15: 7,191,084 I1065N probably damaging Het
Lrrn2 G T 1: 132,937,161 probably benign Het
March9 T A 10: 127,058,303 I144F probably benign Het
Mtnr1a A G 8: 45,087,937 I312V possibly damaging Het
Ngf T A 3: 102,520,353 F139L probably damaging Het
Nipbl T C 15: 8,301,382 I2318V probably benign Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nphs1 A G 7: 30,486,625 D1227G probably benign Het
Olfm3 C A 3: 115,122,275 N285K probably benign Het
Olfr1313 T A 2: 112,072,377 I69F probably benign Het
Olfr3 C A 2: 36,812,681 S137I probably benign Het
Olfr855 G A 9: 19,584,899 D121N probably damaging Het
Olfr870 A G 9: 20,170,795 Y259H probably damaging Het
Olfr887 C T 9: 38,085,631 S265F possibly damaging Het
Osbp2 A G 11: 3,863,486 S128P probably benign Het
Otop2 A T 11: 115,326,859 M174L probably damaging Het
Pard3 A G 8: 127,389,433 T668A possibly damaging Het
Pkhd1 T C 1: 20,547,461 T967A possibly damaging Het
Pls1 A G 9: 95,787,012 V52A probably damaging Het
Ptcd3 T C 6: 71,907,659 K64R probably damaging Het
Pxn T C 5: 115,544,534 W69R possibly damaging Het
Safb G A 17: 56,599,000 probably benign Het
Serinc2 A C 4: 130,265,076 L10R probably damaging Het
Serpinb12 A T 1: 106,946,701 H52L probably benign Het
Serpinf2 A G 11: 75,435,939 Y273H probably damaging Het
Slc2a10 T A 2: 165,514,740 S107T probably benign Het
Slc41a3 T C 6: 90,640,946 L318P probably damaging Het
Slc6a3 A T 13: 73,538,735 I74F probably damaging Het
Snrnp200 G A 2: 127,225,135 G788D probably damaging Het
Snx7 A G 3: 117,846,623 I79T probably benign Het
Sox11 G T 12: 27,341,824 D195E probably benign Het
Ssc4d A G 5: 135,970,220 L43P probably damaging Het
Tab2 A G 10: 7,920,073 I215T probably damaging Het
Ttn C T 2: 76,830,598 V7422I possibly damaging Het
Unc13c A T 9: 73,546,075 probably null Het
Wdr17 T C 8: 54,662,869 D633G probably damaging Het
Wdsub1 A T 2: 59,852,895 M445K probably damaging Het
Xpc A G 6: 91,504,120 F257L probably damaging Het
Other mutations in Rai14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rai14 APN 15 10599711 splice site probably benign
IGL01625:Rai14 APN 15 10572374 missense probably benign 0.30
IGL01925:Rai14 APN 15 10595862 missense possibly damaging 0.88
IGL02053:Rai14 APN 15 10633156 missense probably benign 0.00
IGL02531:Rai14 APN 15 10574782 missense probably damaging 1.00
IGL02748:Rai14 APN 15 10589335 missense probably benign 0.14
IGL02945:Rai14 APN 15 10574709 missense probably benign 0.00
PIT4618001:Rai14 UTSW 15 10575156 missense probably damaging 1.00
R1400:Rai14 UTSW 15 10571548 missense probably damaging 0.98
R1583:Rai14 UTSW 15 10587916 missense probably damaging 1.00
R1686:Rai14 UTSW 15 10592196 missense probably damaging 0.98
R1721:Rai14 UTSW 15 10633228 missense probably damaging 1.00
R1867:Rai14 UTSW 15 10633228 missense probably damaging 1.00
R1868:Rai14 UTSW 15 10633228 missense probably damaging 1.00
R1998:Rai14 UTSW 15 10594981 splice site probably null
R2118:Rai14 UTSW 15 10575166 missense probably benign 0.00
R3161:Rai14 UTSW 15 10633164 missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10633164 missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10633164 missense possibly damaging 0.74
R4049:Rai14 UTSW 15 10592212 missense probably benign 0.30
R4611:Rai14 UTSW 15 10592138 missense probably damaging 1.00
R4760:Rai14 UTSW 15 10575690 missense possibly damaging 0.60
R4863:Rai14 UTSW 15 10572470 missense probably damaging 0.99
R5022:Rai14 UTSW 15 10574506 missense probably damaging 0.96
R5110:Rai14 UTSW 15 10690410 start gained probably benign
R5410:Rai14 UTSW 15 10574938 missense probably damaging 1.00
R5643:Rai14 UTSW 15 10593051 missense probably benign 0.03
R5644:Rai14 UTSW 15 10593051 missense probably benign 0.03
R5934:Rai14 UTSW 15 10575159 missense probably damaging 0.98
R6333:Rai14 UTSW 15 10574936 nonsense probably null
R6338:Rai14 UTSW 15 10574976 missense probably damaging 1.00
R6864:Rai14 UTSW 15 10633168 missense possibly damaging 0.95
R7015:Rai14 UTSW 15 10589315 nonsense probably null
R7155:Rai14 UTSW 15 10595003 missense possibly damaging 0.53
R7480:Rai14 UTSW 15 10571536 missense probably benign 0.02
R7574:Rai14 UTSW 15 10593103 missense probably damaging 1.00
R7578:Rai14 UTSW 15 10574828 missense probably benign
R7578:Rai14 UTSW 15 10593103 missense probably damaging 1.00
R7597:Rai14 UTSW 15 10574851 missense possibly damaging 0.94
R7658:Rai14 UTSW 15 10593103 missense probably damaging 1.00
R7779:Rai14 UTSW 15 10593026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACACGTGCATCAGCCTC -3'
(R):5'- GAGTTAGAGACTAAGCTTGCGG -3'

Sequencing Primer
(F):5'- TGAATGTACTCGGCTGCATC -3'
(R):5'- CTAAGCTTGCGGAGAAGGAGC -3'
Posted On2016-11-09