Mutagenetix > Incidental Mutations

Incidental Mutation 'R5682:Adamtsl3'

443115

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl3

Ensembl Gene

ENSMUSG00000070469

Gene Name

ADAMTS-like 3

Synonyms

punctin-2, 9230119C12Rik

MMRRC Submission

043318-MU

Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5682 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82335694-82614450 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 82606550 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 1590 (N1590I)

Ref Sequence

ENSEMBL: ENSMUSP00000133637 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]

Predicted Effect

probably damaging
Transcript: ENSMUST00000173287
AA Change: N1590I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469
AA Change: N1590I

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	90	136	6.43e-8	SMART
TSP1	355	414	1.59e-1	SMART
TSP1	433	492	3.72e-4	SMART
TSP1	494	547	4.28e-4	SMART
TSP1	579	638	1.85e-2	SMART
TSP1	660	717	1.75e-2	SMART
TSP1	719	773	3.45e-8	SMART
TSP1	775	833	3.67e-3	SMART
TSP1	836	894	8.99e-2	SMART
IGc2	938	1002	7.59e-4	SMART
IG	1213	1296	4.87e0	SMART
IGc2	1326	1388	1.01e-13	SMART
TSP1	1441	1498	1.95e-2	SMART
TSP1	1500	1559	6.76e-2	SMART
TSP1	1616	1666	3.84e-1	SMART
Pfam:PLAC	1674	1704	2.4e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173828
AA Change: N664I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469
AA Change: N664I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Blast:IG	22	79	1e-26	BLAST
SCOP:d1biha4	27	77	2e-5	SMART
IG	283	366	4.87e0	SMART
IGc2	396	458	1.01e-13	SMART
TSP1	511	568	1.95e-2	SMART
TSP1	570	629	6.76e-2	SMART
TSP1	686	736	3.84e-1	SMART

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.4%
20x: 95.3%

Validation Efficiency

Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	C	14: 49,751,586	D642G	probably damaging	Het
Abcc3	A	T	11: 94,392,897	S7T	probably benign	Het
Acot4	G	A	12: 84,038,802	V98M	probably damaging	Het
Acsm2	A	T	7: 119,563,551	N41I	probably benign	Het
Ank3	G	A	10: 69,893,517	G714R	probably damaging	Het
Ash1l	G	A	3: 89,007,607	R1848Q	probably damaging	Het
Atp1a4	A	T	1: 172,254,163	Y141N	probably damaging	Het
Atxn3	A	T	12: 101,958,147	I1N	probably damaging	Het
Avil	A	C	10: 127,014,104	Q608P	probably damaging	Het
Axin1	T	C	17: 26,187,801	V456A	probably benign	Het
Cacna1g	A	G	11: 94,459,114	L635P	probably damaging	Het
Card11	G	A	5: 140,902,911	Q231*	probably null	Het
Ccdc162	G	A	10: 41,556,803	R500*	probably null	Het
Cdh24	T	C	14: 54,637,348	D400G	probably damaging	Het
Cep112	T	C	11: 108,470,312	L164P	probably damaging	Het
Corin	A	G	5: 72,422,154	S224P	possibly damaging	Het
Csgalnact2	T	C	6: 118,120,992	Y371C	probably damaging	Het
Cspg4	A	T	9: 56,886,196	E405V	probably benign	Het
Ctnna3	T	A	10: 64,873,306	M708K	probably damaging	Het
Cyp7a1	T	A	4: 6,268,429	Y432F	probably benign	Het
Dcaf11	T	A	14: 55,563,426	V113E	probably damaging	Het
Dhx29	T	C	13: 112,930,849	I88T	probably damaging	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Elmo2	A	G	2: 165,297,410	F406L	probably damaging	Het
Eps15l1	G	A	8: 72,371,748	Q648*	probably null	Het
Fam171a1	G	A	2: 3,226,089	R753Q	probably damaging	Het
Figla	T	A	6: 86,018,622	V86E	probably damaging	Het
Galnt7	C	A	8: 57,583,933	E141*	probably null	Het
Garnl3	A	G	2: 33,054,173	Y125H	probably damaging	Het
Gnb5	A	G	9: 75,327,241	D74G	probably damaging	Het
Grk1	A	T	8: 13,414,351	I408F	possibly damaging	Het
Has1	A	T	17: 17,844,163	W405R	possibly damaging	Het
Hdac5	A	G	11: 102,213,923		probably benign	Het
Helq	T	A	5: 100,785,304	M555L	probably benign	Het
Hipk2	T	C	6: 38,737,473	N556S	possibly damaging	Het
Htr7	C	A	19: 35,969,871	A248S	probably damaging	Het
Ing3	T	C	6: 21,968,950	S144P	probably damaging	Het
Itgb1	G	A	8: 128,727,068		probably null	Het
Kcnh4	A	T	11: 100,749,802	M466K	possibly damaging	Het
Krit1	T	A	5: 3,830,737	N565K	probably damaging	Het
Limk1	A	C	5: 134,665,205		probably null	Het
Lrif1	T	C	3: 106,732,568	I323T	possibly damaging	Het
Macf1	T	C	4: 123,434,759	E1811G	probably damaging	Het
Mctp2	A	C	7: 72,245,459		probably null	Het
Mmp21	A	G	7: 133,674,629	I495T	probably benign	Het
Mpz	A	T	1: 171,158,894	T126S	possibly damaging	Het
Napsa	A	G	7: 44,585,344	Y301C	possibly damaging	Het
Ncbp1	T	A	4: 46,170,474		probably benign	Het
Nup160	A	G	2: 90,679,811	E47G	probably benign	Het
Olfr923	A	G	9: 38,828,128	I146V	probably benign	Het
Pcdha11	A	G	18: 37,011,449	K198E	probably damaging	Het
Pcdha3	A	G	18: 36,947,987	D594G	probably damaging	Het
Pdcd5	G	A	7: 35,647,188		probably benign	Het
Pdhx	A	T	2: 103,035,340	S166T	probably benign	Het
Pigc	A	G	1: 161,970,947	Y166C	probably damaging	Het
Prkch	C	T	12: 73,697,950	H246Y	probably damaging	Het
Ptk2	A	T	15: 73,262,564	L562*	probably null	Het
Rab3ip	C	T	10: 116,907,103	W439*	probably null	Het
Rasef	T	A	4: 73,740,971	R435*	probably null	Het
Rnf103	C	T	6: 71,508,724		probably benign	Het
Rtel1	T	C	2: 181,349,972	F388L	probably benign	Het
Sds	A	C	5: 120,483,719	S309R	possibly damaging	Het
Sgip1	T	A	4: 102,967,650	D736E	possibly damaging	Het
Sgms2	A	G	3: 131,324,962	Y291H	probably damaging	Het
Sgsm3	A	G	15: 81,011,460		probably null	Het
Siglec1	T	A	2: 131,084,010	I259F	probably damaging	Het
Sik2	G	A	9: 50,917,082	P220L	probably damaging	Het
Slc29a3	A	G	10: 60,716,212	V351A	probably benign	Het
Slc36a3	A	G	11: 55,125,663	S369P	probably benign	Het
Srgap1	A	T	10: 121,805,014	M649K	probably damaging	Het
Thnsl1	A	G	2: 21,212,068	E211G	possibly damaging	Het
Tmprss9	A	G	10: 80,897,373		probably null	Het
Tpgs1	G	A	10: 79,675,587	V188M	probably damaging	Het
Vmn1r201	G	T	13: 22,475,185	V190F	probably damaging	Het
Vmn1r64	A	T	7: 5,883,623	L307Q	possibly damaging	Het
Wbp11	T	C	6: 136,814,254		probably benign	Het
Wdr35	A	G	12: 8,981,125	Y134C	probably damaging	Het
Zan	G	T	5: 137,414,259	C3263*	probably null	Het
Zc3h12c	G	T	9: 52,126,576	D301E	probably damaging	Het
Zfp365	A	C	10: 67,909,807	L47R	probably damaging	Het
Zmym6	C	T	4: 127,104,407	P412L	probably damaging	Het

Other mutations in Adamtsl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01549:Adamtsl3	APN	7	82612448	missense	probably damaging	1.00
IGL01936:Adamtsl3	APN	7	82595371	missense	possibly damaging	0.93
IGL02819:Adamtsl3	APN	7	82574121	missense	probably damaging	0.99
P0012:Adamtsl3	UTSW	7	82574257	missense	probably benign	0.27
R0096:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0096:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0180:Adamtsl3	UTSW	7	82575990	missense	probably benign	0.00
R0270:Adamtsl3	UTSW	7	82556824	missense	probably damaging	1.00
R0295:Adamtsl3	UTSW	7	82548005	critical splice donor site	probably null
R0329:Adamtsl3	UTSW	7	82521990	missense	probably damaging	1.00
R0330:Adamtsl3	UTSW	7	82521990	missense	probably damaging	1.00
R0548:Adamtsl3	UTSW	7	82528983	critical splice donor site	probably null
R0611:Adamtsl3	UTSW	7	82528912	missense	probably damaging	1.00
R0671:Adamtsl3	UTSW	7	82523182	missense	probably damaging	1.00
R0711:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0845:Adamtsl3	UTSW	7	82575996	missense	probably damaging	1.00
R1119:Adamtsl3	UTSW	7	82540317	missense	probably damaging	0.96
R1458:Adamtsl3	UTSW	7	82523320	missense	probably damaging	1.00
R1644:Adamtsl3	UTSW	7	82450090	missense	possibly damaging	0.87
R1691:Adamtsl3	UTSW	7	82499606	missense	probably damaging	1.00
R1838:Adamtsl3	UTSW	7	82493373	missense	probably damaging	1.00
R2131:Adamtsl3	UTSW	7	82578594	missense	probably damaging	1.00
R2245:Adamtsl3	UTSW	7	82450100	missense	probably damaging	1.00
R2274:Adamtsl3	UTSW	7	82606558	missense	probably benign	0.37
R2275:Adamtsl3	UTSW	7	82606558	missense	probably benign	0.37
R2448:Adamtsl3	UTSW	7	82499748	missense	probably damaging	1.00
R3725:Adamtsl3	UTSW	7	82612404	missense	possibly damaging	0.80
R3757:Adamtsl3	UTSW	7	82337207	missense	probably benign	0.01
R3821:Adamtsl3	UTSW	7	82606479	splice site	probably benign
R4618:Adamtsl3	UTSW	7	82606520	missense	probably benign	0.41
R4842:Adamtsl3	UTSW	7	82528861	missense	probably damaging	1.00
R4887:Adamtsl3	UTSW	7	82574614	missense	possibly damaging	0.87
R4888:Adamtsl3	UTSW	7	82574614	missense	possibly damaging	0.87
R4925:Adamtsl3	UTSW	7	82602299	critical splice donor site	probably null
R4960:Adamtsl3	UTSW	7	82566977	missense	probably damaging	0.99
R5026:Adamtsl3	UTSW	7	82576054	missense	probably benign	0.07
R5152:Adamtsl3	UTSW	7	82574544	missense	probably benign	0.11
R5198:Adamtsl3	UTSW	7	82611798	missense	possibly damaging	0.63
R5244:Adamtsl3	UTSW	7	82598069	missense	probably benign	0.02
R5281:Adamtsl3	UTSW	7	82528934	missense	probably damaging	1.00
R5323:Adamtsl3	UTSW	7	82557061	missense	probably damaging	1.00
R5523:Adamtsl3	UTSW	7	82574442	missense	possibly damaging	0.86
R5602:Adamtsl3	UTSW	7	82557239	missense	possibly damaging	0.89
R5638:Adamtsl3	UTSW	7	82611750	missense	probably damaging	0.99
R5782:Adamtsl3	UTSW	7	82540286	splice site	probably null
R5946:Adamtsl3	UTSW	7	82576057	missense	probably damaging	0.98
R6091:Adamtsl3	UTSW	7	82465621	missense	probably damaging	1.00
R6258:Adamtsl3	UTSW	7	82528983	critical splice donor site	probably null
R6500:Adamtsl3	UTSW	7	82578610	missense	probably benign	0.00
R6765:Adamtsl3	UTSW	7	82567024	missense	possibly damaging	0.60
R6785:Adamtsl3	UTSW	7	82522004	missense	probably damaging	0.99
R6982:Adamtsl3	UTSW	7	82515063	missense	probably damaging	1.00
R7109:Adamtsl3	UTSW	7	82611861	missense
R7341:Adamtsl3	UTSW	7	82556874	missense	probably damaging	1.00
R7402:Adamtsl3	UTSW	7	82578617	missense	probably damaging	0.96
R7506:Adamtsl3	UTSW	7	82514978	missense	probably damaging	1.00
R7549:Adamtsl3	UTSW	7	82573909	missense	probably damaging	1.00
R7575:Adamtsl3	UTSW	7	82574548	missense	possibly damaging	0.85
R7592:Adamtsl3	UTSW	7	82337251	missense	probably benign	0.00
R7617:Adamtsl3	UTSW	7	82556846	splice site	probably null
R7654:Adamtsl3	UTSW	7	82574494	missense	probably benign
R7721:Adamtsl3	UTSW	7	82606520	missense	possibly damaging	0.62
R7784:Adamtsl3	UTSW	7	82573989	missense	probably damaging	1.00
R7858:Adamtsl3	UTSW	7	82450163	missense	probably damaging	1.00
R8109:Adamtsl3	UTSW	7	82602279	missense	possibly damaging	0.94
R8125:Adamtsl3	UTSW	7	82450333	splice site	probably null
R8211:Adamtsl3	UTSW	7	82523163	missense	probably damaging	1.00
R8348:Adamtsl3	UTSW	7	82603799	missense	possibly damaging	0.89
R8360:Adamtsl3	UTSW	7	82547979	missense	probably damaging	1.00
R8448:Adamtsl3	UTSW	7	82603799	missense	possibly damaging	0.89
R8465:Adamtsl3	UTSW	7	82598122	missense	probably benign	0.43
R8547:Adamtsl3	UTSW	7	82428413	missense	probably damaging	1.00
R8551:Adamtsl3	UTSW	7	82540470	missense	probably benign	0.34
RF005:Adamtsl3	UTSW	7	82612395	missense
X0003:Adamtsl3	UTSW	7	82611759	nonsense	probably null
X0063:Adamtsl3	UTSW	7	82574157	missense	probably benign	0.25
Z1088:Adamtsl3	UTSW	7	82499714	missense	probably damaging	1.00
Z1088:Adamtsl3	UTSW	7	82540325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTAACTCACAGCTGGTCCCT -3'
(R):5'- CCCCTTTAGAGTATTTATTGGCCA -3'

Sequencing Primer
(F):5'- CTGGTCCCTGGAGCTTGTC -3'
(R):5'- TTCAGGCAGTTTTGTCCC -3'

Posted On

2016-11-09