Incidental Mutation 'R5683:Pak6'
ID443171
Institutional Source Beutler Lab
Gene Symbol Pak6
Ensembl Gene ENSMUSG00000074923
Gene Namep21 (RAC1) activated kinase 6
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5683 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118663303-118698020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118693912 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 469 (Y469N)
Ref Sequence ENSEMBL: ENSMUSP00000106477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099557] [ENSMUST00000110853]
Predicted Effect probably damaging
Transcript: ENSMUST00000099557
AA Change: Y469N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097153
Gene: ENSMUSG00000074923
AA Change: Y469N

DomainStartEndE-ValueType
PBD 12 47 4.47e-11 SMART
S_TKc 408 659 2.38e-89 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110853
AA Change: Y469N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106477
Gene: ENSMUSG00000074923
AA Change: Y469N

DomainStartEndE-ValueType
PBD 12 47 4.47e-11 SMART
S_TKc 408 659 2.38e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132577
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of p21-stimulated serine/threonine protein kinases, which contain an amino-terminal Cdc42/Rac interactive binding (CRIB) domain and a carboxyl-terminal kinase domain. These kinases function in a number of cellular processes, including cytoskeleton rearrangement, apoptosis, and the mitogen-activated protein (MAP) kinase signaling pathway. The protein encoded by this gene interacts with androgen receptor (AR) and translocates to the nucleus, where it is involved in transcriptional regulation. Changes in expression of this gene have been linked to prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele do not exhibit any abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A C 11: 72,202,440 M22R probably benign Het
Acad11 A G 9: 104,084,283 E397G probably damaging Het
Actrt3 A T 3: 30,598,278 D222E probably benign Het
Akap11 A T 14: 78,512,578 S790T probably damaging Het
Arhgap5 T A 12: 52,519,586 D1113E probably benign Het
Arl2 C A 19: 6,134,764 R153L probably benign Het
B3glct T A 5: 149,696,437 M19K probably benign Het
Ccdc138 C A 10: 58,540,819 Q425K probably damaging Het
Ccdc178 T A 18: 22,130,122 K143N probably benign Het
Cd200r4 T A 16: 44,832,948 I73K probably benign Het
Chaf1b A G 16: 93,887,142 K94E possibly damaging Het
Cmtm2a T C 8: 104,293,044 probably null Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Fnbp4 C A 2: 90,752,862 N277K probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Itsn1 T C 16: 91,905,380 Y37H probably benign Het
Kdm8 A G 7: 125,455,173 Y16C possibly damaging Het
Kif1b A T 4: 149,222,261 Y881N probably damaging Het
Lhcgr C T 17: 88,772,019 V80I probably benign Het
Lrriq1 T A 10: 103,173,375 L1082F probably damaging Het
Met A G 6: 17,571,744 Y1354C probably damaging Het
Nbea A G 3: 55,628,586 L2859P possibly damaging Het
Ndufaf5 T A 2: 140,202,923 M279K possibly damaging Het
Nlrp4e T C 7: 23,353,272 I872T probably damaging Het
Npnt A T 3: 132,906,840 probably null Het
Nsd1 G A 13: 55,246,148 V521I probably benign Het
Olfr138 G A 17: 38,275,546 M258I possibly damaging Het
Parp4 C T 14: 56,647,429 R1322* probably null Het
Pax6 T C 2: 105,685,907 Y177H probably benign Het
Pcdhb4 A T 18: 37,308,989 T451S probably benign Het
Pcdhgb5 A T 18: 37,731,854 D234V probably damaging Het
Pramef6 A G 4: 143,895,853 S311P probably damaging Het
Ralb G A 1: 119,475,956 A147V possibly damaging Het
Rgs11 A G 17: 26,205,181 K196E probably benign Het
Rnft1 A T 11: 86,491,790 T280S probably benign Het
Slco4c1 G T 1: 96,867,834 H166Q probably damaging Het
Sycp3 T C 10: 88,472,935 S248P probably damaging Het
Tab2 A G 10: 7,919,112 probably null Het
Tgm6 T C 2: 130,138,955 M224T probably damaging Het
Topbp1 A T 9: 103,312,804 E193V possibly damaging Het
Trim36 T C 18: 46,169,292 Y551C probably damaging Het
Ttc17 T C 2: 94,362,521 Y628C probably damaging Het
Vmn1r180 A C 7: 23,953,210 D266A possibly damaging Het
Vmn2r104 T A 17: 20,040,719 K481* probably null Het
Zc3hav1 A G 6: 38,307,237 V981A probably damaging Het
Other mutations in Pak6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Pak6 APN 2 118689845 missense possibly damaging 0.58
IGL00979:Pak6 APN 2 118696482 missense probably damaging 1.00
IGL01577:Pak6 APN 2 118693648 missense probably benign 0.00
IGL01928:Pak6 APN 2 118689864 missense probably damaging 1.00
IGL01951:Pak6 APN 2 118693260 missense probably benign
IGL02387:Pak6 APN 2 118693233 missense probably benign
IGL03302:Pak6 APN 2 118693303 missense probably benign
bedamned UTSW 2 118694007 splice site probably benign
bequeathed UTSW 2 118693522 missense probably damaging 0.96
R0126:Pak6 UTSW 2 118690332 missense possibly damaging 0.86
R0883:Pak6 UTSW 2 118693687 missense probably damaging 1.00
R1128:Pak6 UTSW 2 118696509 missense probably benign 0.00
R2073:Pak6 UTSW 2 118688851 missense probably damaging 1.00
R2508:Pak6 UTSW 2 118694569 nonsense probably null
R2920:Pak6 UTSW 2 118694007 splice site probably benign
R3118:Pak6 UTSW 2 118689741 missense probably damaging 1.00
R3689:Pak6 UTSW 2 118693440 nonsense probably null
R3762:Pak6 UTSW 2 118696477 missense probably damaging 0.99
R4589:Pak6 UTSW 2 118696540 missense probably damaging 1.00
R4976:Pak6 UTSW 2 118694548 missense probably damaging 1.00
R5119:Pak6 UTSW 2 118694548 missense probably damaging 1.00
R5206:Pak6 UTSW 2 118693303 missense probably benign
R7232:Pak6 UTSW 2 118693522 missense probably damaging 0.96
R7236:Pak6 UTSW 2 118693428 missense probably benign 0.26
R7292:Pak6 UTSW 2 118693591 missense possibly damaging 0.95
R7623:Pak6 UTSW 2 118694587 missense probably damaging 1.00
R7823:Pak6 UTSW 2 118695312 missense probably benign 0.02
R8190:Pak6 UTSW 2 118690097 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGGAGCTGCTCTTTAATGAGG -3'
(R):5'- GGCAGGAGTCTAGTAAGATCAGTC -3'

Sequencing Primer
(F):5'- CTGCTCTTTAATGAGGTGGGGACC -3'
(R):5'- GTAAGATCAGTCCTATTGGCCAG -3'
Posted On2016-11-09