Incidental Mutation 'R5683:Met'
ID443180
Institutional Source Beutler Lab
Gene Symbol Met
Ensembl Gene ENSMUSG00000009376
Gene Namemet proto-oncogene
SynonymsPar4, HGF receptor, c-Met
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5683 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location17463800-17573980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17571744 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1354 (Y1354C)
Ref Sequence ENSEMBL: ENSMUSP00000111103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443]
Predicted Effect probably damaging
Transcript: ENSMUST00000080469
AA Change: Y1354C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376
AA Change: Y1354C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115442
AA Change: Y1354C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376
AA Change: Y1354C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115443
AA Change: Y1354C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376
AA Change: Y1354C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A C 11: 72,202,440 M22R probably benign Het
Acad11 A G 9: 104,084,283 E397G probably damaging Het
Actrt3 A T 3: 30,598,278 D222E probably benign Het
Akap11 A T 14: 78,512,578 S790T probably damaging Het
Arhgap5 T A 12: 52,519,586 D1113E probably benign Het
Arl2 C A 19: 6,134,764 R153L probably benign Het
B3glct T A 5: 149,696,437 M19K probably benign Het
Ccdc138 C A 10: 58,540,819 Q425K probably damaging Het
Ccdc178 T A 18: 22,130,122 K143N probably benign Het
Cd200r4 T A 16: 44,832,948 I73K probably benign Het
Chaf1b A G 16: 93,887,142 K94E possibly damaging Het
Cmtm2a T C 8: 104,293,044 probably null Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Fnbp4 C A 2: 90,752,862 N277K probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Itsn1 T C 16: 91,905,380 Y37H probably benign Het
Kdm8 A G 7: 125,455,173 Y16C possibly damaging Het
Kif1b A T 4: 149,222,261 Y881N probably damaging Het
Lhcgr C T 17: 88,772,019 V80I probably benign Het
Lrriq1 T A 10: 103,173,375 L1082F probably damaging Het
Nbea A G 3: 55,628,586 L2859P possibly damaging Het
Ndufaf5 T A 2: 140,202,923 M279K possibly damaging Het
Nlrp4e T C 7: 23,353,272 I872T probably damaging Het
Npnt A T 3: 132,906,840 probably null Het
Nsd1 G A 13: 55,246,148 V521I probably benign Het
Olfr138 G A 17: 38,275,546 M258I possibly damaging Het
Pak6 T A 2: 118,693,912 Y469N probably damaging Het
Parp4 C T 14: 56,647,429 R1322* probably null Het
Pax6 T C 2: 105,685,907 Y177H probably benign Het
Pcdhb4 A T 18: 37,308,989 T451S probably benign Het
Pcdhgb5 A T 18: 37,731,854 D234V probably damaging Het
Pramef6 A G 4: 143,895,853 S311P probably damaging Het
Ralb G A 1: 119,475,956 A147V possibly damaging Het
Rgs11 A G 17: 26,205,181 K196E probably benign Het
Rnft1 A T 11: 86,491,790 T280S probably benign Het
Slco4c1 G T 1: 96,867,834 H166Q probably damaging Het
Sycp3 T C 10: 88,472,935 S248P probably damaging Het
Tab2 A G 10: 7,919,112 probably null Het
Tgm6 T C 2: 130,138,955 M224T probably damaging Het
Topbp1 A T 9: 103,312,804 E193V possibly damaging Het
Trim36 T C 18: 46,169,292 Y551C probably damaging Het
Ttc17 T C 2: 94,362,521 Y628C probably damaging Het
Vmn1r180 A C 7: 23,953,210 D266A possibly damaging Het
Vmn2r104 T A 17: 20,040,719 K481* probably null Het
Zc3hav1 A G 6: 38,307,237 V981A probably damaging Het
Other mutations in Met
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Met APN 6 17534937 unclassified probably benign
IGL01066:Met APN 6 17535105 critical splice donor site probably null
IGL01344:Met APN 6 17547032 missense probably benign 0.44
IGL01413:Met APN 6 17558896 splice site probably benign
IGL01608:Met APN 6 17558730 missense probably damaging 1.00
IGL01613:Met APN 6 17540577 missense probably damaging 1.00
IGL01820:Met APN 6 17534231 missense possibly damaging 0.89
IGL01843:Met APN 6 17491701 missense probably damaging 1.00
IGL02014:Met APN 6 17527257 splice site probably benign
IGL02027:Met APN 6 17563727 splice site probably benign
IGL02243:Met APN 6 17549094 missense probably damaging 1.00
IGL02373:Met APN 6 17491529 missense probably damaging 1.00
IGL02616:Met APN 6 17553347 missense probably damaging 1.00
IGL02702:Met APN 6 17534143 missense possibly damaging 0.92
IGL02704:Met APN 6 17491257 missense possibly damaging 0.62
IGL02714:Met APN 6 17491852 nonsense probably null
IGL02936:Met APN 6 17553397 missense probably damaging 1.00
IGL02943:Met APN 6 17535929 missense possibly damaging 0.84
IGL03057:Met APN 6 17558766 missense probably damaging 1.00
IGL03124:Met APN 6 17492078 missense probably benign 0.27
IGL03171:Met APN 6 17562273 splice site probably benign
IGL03266:Met APN 6 17540538 missense possibly damaging 0.61
IGL03285:Met APN 6 17553337 missense probably damaging 0.98
R0453:Met UTSW 6 17534198 missense possibly damaging 0.88
R0543:Met UTSW 6 17491970 missense probably damaging 1.00
R0601:Met UTSW 6 17555632 splice site probably null
R0652:Met UTSW 6 17491710 missense probably benign 0.00
R0941:Met UTSW 6 17491394 missense probably damaging 1.00
R1142:Met UTSW 6 17527183 nonsense probably null
R1553:Met UTSW 6 17491461 missense probably benign 0.01
R1569:Met UTSW 6 17531504 nonsense probably null
R1744:Met UTSW 6 17540646 missense possibly damaging 0.47
R2224:Met UTSW 6 17563722 splice site probably null
R2308:Met UTSW 6 17491742 missense probably benign 0.00
R2369:Met UTSW 6 17531528 missense probably benign 0.04
R2393:Met UTSW 6 17534198 missense probably damaging 0.99
R2419:Met UTSW 6 17535830 splice site probably benign
R2483:Met UTSW 6 17549086 missense probably damaging 1.00
R2511:Met UTSW 6 17491967 missense probably damaging 1.00
R3622:Met UTSW 6 17549086 missense probably damaging 1.00
R3623:Met UTSW 6 17549086 missense probably damaging 1.00
R3624:Met UTSW 6 17549086 missense probably damaging 1.00
R4050:Met UTSW 6 17533984 missense probably benign
R4051:Met UTSW 6 17548729 missense possibly damaging 0.86
R4159:Met UTSW 6 17562272 splice site probably null
R4208:Met UTSW 6 17548729 missense possibly damaging 0.86
R4622:Met UTSW 6 17513384 missense probably benign 0.19
R4672:Met UTSW 6 17571804 missense probably benign 0.33
R4737:Met UTSW 6 17491541 missense probably damaging 1.00
R4738:Met UTSW 6 17491541 missense probably damaging 1.00
R4834:Met UTSW 6 17491413 missense probably damaging 0.97
R4846:Met UTSW 6 17491929 missense probably damaging 0.99
R4855:Met UTSW 6 17558797 missense probably damaging 1.00
R4878:Met UTSW 6 17549059 missense probably damaging 1.00
R4902:Met UTSW 6 17546996 missense probably damaging 1.00
R5208:Met UTSW 6 17526423 nonsense probably null
R5355:Met UTSW 6 17491362 missense probably damaging 1.00
R5415:Met UTSW 6 17527085 missense probably benign 0.01
R5556:Met UTSW 6 17534176 missense probably benign 0.04
R5590:Met UTSW 6 17548782 missense probably benign 0.00
R5872:Met UTSW 6 17562198 missense probably damaging 1.00
R5891:Met UTSW 6 17491539 missense probably benign 0.02
R5895:Met UTSW 6 17531582 missense probably benign 0.02
R6063:Met UTSW 6 17491968 missense probably damaging 1.00
R6262:Met UTSW 6 17553404 missense probably benign 0.00
R6362:Met UTSW 6 17558733 missense probably damaging 1.00
R6747:Met UTSW 6 17571467 missense probably damaging 1.00
R6966:Met UTSW 6 17531532 missense possibly damaging 0.65
R6989:Met UTSW 6 17535928 missense possibly damaging 0.67
R6989:Met UTSW 6 17535929 missense probably damaging 1.00
R7017:Met UTSW 6 17491287 nonsense probably null
R7037:Met UTSW 6 17547128 intron probably benign
R7141:Met UTSW 6 17527155 missense probably benign 0.01
R7242:Met UTSW 6 17491317 missense probably damaging 1.00
R7282:Met UTSW 6 17547012 nonsense probably null
R7624:Met UTSW 6 17558835 missense probably damaging 1.00
R7770:Met UTSW 6 17491407 missense possibly damaging 0.79
R7797:Met UTSW 6 17533953 missense probably damaging 1.00
R8082:Met UTSW 6 17492313 missense probably damaging 0.98
R8109:Met UTSW 6 17562237 missense probably damaging 1.00
R8162:Met UTSW 6 17547062 missense probably damaging 0.98
R8315:Met UTSW 6 17533957 missense probably damaging 0.99
R8325:Met UTSW 6 17571672 missense probably damaging 1.00
R8348:Met UTSW 6 17571800 missense probably benign 0.00
R8354:Met UTSW 6 17491769 missense probably damaging 1.00
R8448:Met UTSW 6 17571800 missense probably benign 0.00
R8454:Met UTSW 6 17491769 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATTATGCCTCTCACAGC -3'
(R):5'- ATGTTTCATAGTGGTGCAGTTACCG -3'

Sequencing Primer
(F):5'- CTCACAGCATTTCTTTCTGAAACAGG -3'
(R):5'- TGGTGCAGTTACCGCAAAAGC -3'
Posted On2016-11-09