Incidental Mutation 'R5683:Zc3hav1'
ID443181
Institutional Source Beutler Lab
Gene Symbol Zc3hav1
Ensembl Gene ENSMUSG00000029826
Gene Namezinc finger CCCH type, antiviral 1
Synonyms9130009D18Rik, 2900058M19Rik, ZAP, 1200014N16Rik, 9830115L13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5683 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location38305286-38354603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38307237 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 981 (V981A)
Ref Sequence ENSEMBL: ENSMUSP00000110550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114900] [ENSMUST00000143702]
Predicted Effect probably damaging
Transcript: ENSMUST00000114900
AA Change: V981A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110550
Gene: ENSMUSG00000029826
AA Change: V981A

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 1.94e-5 PROSPERO
internal_repeat_1 166 208 1.94e-5 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Pfam:WWE 695 772 2.8e-15 PFAM
Pfam:PARP 817 986 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143702
SMART Domains Protein: ENSMUSP00000144312
Gene: ENSMUSG00000029826

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 1.8e-5 PROSPERO
internal_repeat_1 166 208 1.8e-5 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Pfam:WWE 695 772 1e-15 PFAM
Pfam:PARP 817 922 1.9e-12 PFAM
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CCCH-type zinc finger protein that is thought to prevent infection by retroviruses. Studies of the rat homolog indicate that the protein may primarily function to inhibit viral gene expression and induce an innate immunity to viral infection. Alternative splicing occurs at this locus and two variants, each encoding distinct isoforms, are described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced murine leukemia virus replication efficiency in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A C 11: 72,202,440 M22R probably benign Het
Acad11 A G 9: 104,084,283 E397G probably damaging Het
Actrt3 A T 3: 30,598,278 D222E probably benign Het
Akap11 A T 14: 78,512,578 S790T probably damaging Het
Arhgap5 T A 12: 52,519,586 D1113E probably benign Het
Arl2 C A 19: 6,134,764 R153L probably benign Het
B3glct T A 5: 149,696,437 M19K probably benign Het
Ccdc138 C A 10: 58,540,819 Q425K probably damaging Het
Ccdc178 T A 18: 22,130,122 K143N probably benign Het
Cd200r4 T A 16: 44,832,948 I73K probably benign Het
Chaf1b A G 16: 93,887,142 K94E possibly damaging Het
Cmtm2a T C 8: 104,293,044 probably null Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Fnbp4 C A 2: 90,752,862 N277K probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Itsn1 T C 16: 91,905,380 Y37H probably benign Het
Kdm8 A G 7: 125,455,173 Y16C possibly damaging Het
Kif1b A T 4: 149,222,261 Y881N probably damaging Het
Lhcgr C T 17: 88,772,019 V80I probably benign Het
Lrriq1 T A 10: 103,173,375 L1082F probably damaging Het
Met A G 6: 17,571,744 Y1354C probably damaging Het
Nbea A G 3: 55,628,586 L2859P possibly damaging Het
Ndufaf5 T A 2: 140,202,923 M279K possibly damaging Het
Nlrp4e T C 7: 23,353,272 I872T probably damaging Het
Npnt A T 3: 132,906,840 probably null Het
Nsd1 G A 13: 55,246,148 V521I probably benign Het
Olfr138 G A 17: 38,275,546 M258I possibly damaging Het
Pak6 T A 2: 118,693,912 Y469N probably damaging Het
Parp4 C T 14: 56,647,429 R1322* probably null Het
Pax6 T C 2: 105,685,907 Y177H probably benign Het
Pcdhb4 A T 18: 37,308,989 T451S probably benign Het
Pcdhgb5 A T 18: 37,731,854 D234V probably damaging Het
Pramef6 A G 4: 143,895,853 S311P probably damaging Het
Ralb G A 1: 119,475,956 A147V possibly damaging Het
Rgs11 A G 17: 26,205,181 K196E probably benign Het
Rnft1 A T 11: 86,491,790 T280S probably benign Het
Slco4c1 G T 1: 96,867,834 H166Q probably damaging Het
Sycp3 T C 10: 88,472,935 S248P probably damaging Het
Tab2 A G 10: 7,919,112 probably null Het
Tgm6 T C 2: 130,138,955 M224T probably damaging Het
Topbp1 A T 9: 103,312,804 E193V possibly damaging Het
Trim36 T C 18: 46,169,292 Y551C probably damaging Het
Ttc17 T C 2: 94,362,521 Y628C probably damaging Het
Vmn1r180 A C 7: 23,953,210 D266A possibly damaging Het
Vmn2r104 T A 17: 20,040,719 K481* probably null Het
Other mutations in Zc3hav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Zc3hav1 APN 6 38319833 splice site probably null
IGL02225:Zc3hav1 APN 6 38340341 missense probably damaging 1.00
IGL02266:Zc3hav1 APN 6 38332168 missense probably benign 0.01
IGL02458:Zc3hav1 APN 6 38340329 missense probably damaging 1.00
IGL02626:Zc3hav1 APN 6 38332991 missense probably damaging 0.96
IGL02725:Zc3hav1 APN 6 38332192 missense probably damaging 0.98
IGL02958:Zc3hav1 APN 6 38332984 missense probably damaging 1.00
IGL03104:Zc3hav1 APN 6 38340343 missense probably damaging 1.00
IGL03137:Zc3hav1 APN 6 38332394 missense probably benign
IGL03238:Zc3hav1 APN 6 38332750 missense probably damaging 0.99
IGL03380:Zc3hav1 APN 6 38336558 missense probably damaging 1.00
IGL03055:Zc3hav1 UTSW 6 38316316 splice site probably null
P0038:Zc3hav1 UTSW 6 38332534 missense probably damaging 0.98
R0006:Zc3hav1 UTSW 6 38319702 critical splice donor site probably null
R0207:Zc3hav1 UTSW 6 38311174 missense probably benign 0.00
R0255:Zc3hav1 UTSW 6 38336550 missense probably damaging 1.00
R0452:Zc3hav1 UTSW 6 38307437 missense probably benign 0.01
R0505:Zc3hav1 UTSW 6 38332664 missense probably damaging 1.00
R0865:Zc3hav1 UTSW 6 38353902 splice site probably benign
R1281:Zc3hav1 UTSW 6 38353937 missense probably damaging 1.00
R1531:Zc3hav1 UTSW 6 38307235 missense possibly damaging 0.91
R1873:Zc3hav1 UTSW 6 38332757 missense possibly damaging 0.50
R1991:Zc3hav1 UTSW 6 38336517 missense probably damaging 1.00
R2149:Zc3hav1 UTSW 6 38336537 missense probably damaging 1.00
R2184:Zc3hav1 UTSW 6 38307408 missense probably damaging 0.99
R2365:Zc3hav1 UTSW 6 38340233 missense probably damaging 1.00
R2924:Zc3hav1 UTSW 6 38354110 missense probably damaging 0.97
R3237:Zc3hav1 UTSW 6 38319715 missense probably damaging 1.00
R3710:Zc3hav1 UTSW 6 38332162 missense probably benign 0.35
R5684:Zc3hav1 UTSW 6 38311279 missense probably benign 0.01
R5905:Zc3hav1 UTSW 6 38307340 missense probably benign 0.03
R5959:Zc3hav1 UTSW 6 38307444 missense probably benign 0.01
R6028:Zc3hav1 UTSW 6 38307340 missense probably benign 0.03
R6261:Zc3hav1 UTSW 6 38333000 missense probably benign 0.24
R6465:Zc3hav1 UTSW 6 38331849 missense possibly damaging 0.85
R6682:Zc3hav1 UTSW 6 38325195 missense probably benign 0.02
R6831:Zc3hav1 UTSW 6 38332168 missense probably benign 0.01
R7082:Zc3hav1 UTSW 6 38332393 nonsense probably null
R7196:Zc3hav1 UTSW 6 38329272 missense probably benign
R7248:Zc3hav1 UTSW 6 38353976 missense probably benign 0.04
R7319:Zc3hav1 UTSW 6 38332274 missense probably benign
R7506:Zc3hav1 UTSW 6 38332940 nonsense probably null
R7593:Zc3hav1 UTSW 6 38329186 missense probably benign 0.01
R7788:Zc3hav1 UTSW 6 38332756 missense probably benign 0.02
R7885:Zc3hav1 UTSW 6 38336663 missense possibly damaging 0.82
R7892:Zc3hav1 UTSW 6 38329221 missense probably benign 0.25
R8109:Zc3hav1 UTSW 6 38329179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGATACTGGCTGGTATTG -3'
(R):5'- TTCCAGAGGCACTGTCATG -3'

Sequencing Primer
(F):5'- TCAGACTTAGGAACAATGTGTAGG -3'
(R):5'- AGGCACTGTCATGTTCGTAGCC -3'
Posted On2016-11-09