Incidental Mutation 'R5683:Ccdc138'
ID443191
Institutional Source Beutler Lab
Gene Symbol Ccdc138
Ensembl Gene ENSMUSG00000038010
Gene Namecoiled-coil domain containing 138
Synonyms6230424H07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R5683 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location58497948-58576244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58540819 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 425 (Q425K)
Ref Sequence ENSEMBL: ENSMUSP00000043040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036576]
Predicted Effect probably damaging
Transcript: ENSMUST00000036576
AA Change: Q425K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043040
Gene: ENSMUSG00000038010
AA Change: Q425K

DomainStartEndE-ValueType
coiled coil region 259 339 N/A INTRINSIC
low complexity region 355 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A C 11: 72,202,440 M22R probably benign Het
Acad11 A G 9: 104,084,283 E397G probably damaging Het
Actrt3 A T 3: 30,598,278 D222E probably benign Het
Akap11 A T 14: 78,512,578 S790T probably damaging Het
Arhgap5 T A 12: 52,519,586 D1113E probably benign Het
Arl2 C A 19: 6,134,764 R153L probably benign Het
B3glct T A 5: 149,696,437 M19K probably benign Het
Ccdc178 T A 18: 22,130,122 K143N probably benign Het
Cd200r4 T A 16: 44,832,948 I73K probably benign Het
Chaf1b A G 16: 93,887,142 K94E possibly damaging Het
Cmtm2a T C 8: 104,293,044 probably null Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Fnbp4 C A 2: 90,752,862 N277K probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Itsn1 T C 16: 91,905,380 Y37H probably benign Het
Kdm8 A G 7: 125,455,173 Y16C possibly damaging Het
Kif1b A T 4: 149,222,261 Y881N probably damaging Het
Lhcgr C T 17: 88,772,019 V80I probably benign Het
Lrriq1 T A 10: 103,173,375 L1082F probably damaging Het
Met A G 6: 17,571,744 Y1354C probably damaging Het
Nbea A G 3: 55,628,586 L2859P possibly damaging Het
Ndufaf5 T A 2: 140,202,923 M279K possibly damaging Het
Nlrp4e T C 7: 23,353,272 I872T probably damaging Het
Npnt A T 3: 132,906,840 probably null Het
Nsd1 G A 13: 55,246,148 V521I probably benign Het
Olfr138 G A 17: 38,275,546 M258I possibly damaging Het
Pak6 T A 2: 118,693,912 Y469N probably damaging Het
Parp4 C T 14: 56,647,429 R1322* probably null Het
Pax6 T C 2: 105,685,907 Y177H probably benign Het
Pcdhb4 A T 18: 37,308,989 T451S probably benign Het
Pcdhgb5 A T 18: 37,731,854 D234V probably damaging Het
Pramef6 A G 4: 143,895,853 S311P probably damaging Het
Ralb G A 1: 119,475,956 A147V possibly damaging Het
Rgs11 A G 17: 26,205,181 K196E probably benign Het
Rnft1 A T 11: 86,491,790 T280S probably benign Het
Slco4c1 G T 1: 96,867,834 H166Q probably damaging Het
Sycp3 T C 10: 88,472,935 S248P probably damaging Het
Tab2 A G 10: 7,919,112 probably null Het
Tgm6 T C 2: 130,138,955 M224T probably damaging Het
Topbp1 A T 9: 103,312,804 E193V possibly damaging Het
Trim36 T C 18: 46,169,292 Y551C probably damaging Het
Ttc17 T C 2: 94,362,521 Y628C probably damaging Het
Vmn1r180 A C 7: 23,953,210 D266A possibly damaging Het
Vmn2r104 T A 17: 20,040,719 K481* probably null Het
Zc3hav1 A G 6: 38,307,237 V981A probably damaging Het
Other mutations in Ccdc138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ccdc138 APN 10 58575715 missense probably damaging 1.00
IGL00957:Ccdc138 APN 10 58529016 splice site probably benign
IGL01012:Ccdc138 APN 10 58540915 critical splice donor site probably null
IGL01725:Ccdc138 APN 10 58528923 missense possibly damaging 0.50
IGL01996:Ccdc138 APN 10 58562030 missense probably damaging 1.00
IGL02083:Ccdc138 APN 10 58544914 splice site probably benign
IGL02652:Ccdc138 APN 10 58513079 missense probably benign 0.00
IGL02820:Ccdc138 APN 10 58528899 splice site probably benign
IGL02934:Ccdc138 APN 10 58573580 splice site probably benign
IGL03231:Ccdc138 APN 10 58573706 missense probably damaging 1.00
R0128:Ccdc138 UTSW 10 58528360 missense probably damaging 1.00
R0271:Ccdc138 UTSW 10 58575823 missense probably damaging 0.99
R0480:Ccdc138 UTSW 10 58561967 missense probably damaging 1.00
R0560:Ccdc138 UTSW 10 58575717 missense probably damaging 1.00
R0645:Ccdc138 UTSW 10 58575720 missense probably damaging 1.00
R1405:Ccdc138 UTSW 10 58545117 splice site probably benign
R2032:Ccdc138 UTSW 10 58513162 missense possibly damaging 0.71
R2097:Ccdc138 UTSW 10 58561937 nonsense probably null
R2350:Ccdc138 UTSW 10 58561893 splice site probably benign
R2571:Ccdc138 UTSW 10 58513222 missense probably benign 0.25
R3787:Ccdc138 UTSW 10 58538270 missense probably damaging 1.00
R3805:Ccdc138 UTSW 10 58561997 missense possibly damaging 0.95
R4582:Ccdc138 UTSW 10 58507643 critical splice donor site probably null
R4630:Ccdc138 UTSW 10 58573655 missense probably damaging 1.00
R4801:Ccdc138 UTSW 10 58573643 missense probably damaging 1.00
R4802:Ccdc138 UTSW 10 58573643 missense probably damaging 1.00
R4883:Ccdc138 UTSW 10 58561996 missense probably benign 0.03
R4908:Ccdc138 UTSW 10 58544995 missense possibly damaging 0.84
R5032:Ccdc138 UTSW 10 58573636 missense probably damaging 1.00
R5155:Ccdc138 UTSW 10 58507572 missense probably benign 0.00
R5287:Ccdc138 UTSW 10 58575705 missense possibly damaging 0.89
R5963:Ccdc138 UTSW 10 58575757 missense possibly damaging 0.90
R6530:Ccdc138 UTSW 10 58544968 missense probably damaging 1.00
R7148:Ccdc138 UTSW 10 58538280 missense probably damaging 1.00
R7217:Ccdc138 UTSW 10 58509600 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CACGTGGATTGTCTACTCAATGC -3'
(R):5'- ACCCTTAGGACAGTATTGAACAG -3'

Sequencing Primer
(F):5'- TGGATTGTCTACTCAATGCATTATTC -3'
(R):5'- CCTTAGGACAGTATTGAACAGAGAAG -3'
Posted On2016-11-09