Incidental Mutation 'R5683:Olfr138'
ID443206
Institutional Source Beutler Lab
Gene Symbol Olfr138
Ensembl Gene ENSMUSG00000057443
Gene Nameolfactory receptor 138
SynonymsGA_x6K02T2PSCP-2718585-2719523, MOR256-40P, Olfr89
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5683 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location38261035-38276410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38275546 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 258 (M258I)
Ref Sequence ENSEMBL: ENSMUSP00000133828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071871] [ENSMUST00000172843] [ENSMUST00000173841]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071871
AA Change: M258I

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071767
Gene: ENSMUSG00000057443
AA Change: M258I

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.4e-33 PFAM
Pfam:7tm_4 139 283 8.1e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172843
AA Change: M258I

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133698
Gene: ENSMUSG00000057443
AA Change: M258I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-46 PFAM
Pfam:7tm_1 41 290 1.9e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173841
AA Change: M258I

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133828
Gene: ENSMUSG00000057443
AA Change: M258I

DomainStartEndE-ValueType
Pfam:7tm_1 41 123 1.7e-15 PFAM
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A C 11: 72,202,440 M22R probably benign Het
Acad11 A G 9: 104,084,283 E397G probably damaging Het
Actrt3 A T 3: 30,598,278 D222E probably benign Het
Akap11 A T 14: 78,512,578 S790T probably damaging Het
Arhgap5 T A 12: 52,519,586 D1113E probably benign Het
Arl2 C A 19: 6,134,764 R153L probably benign Het
B3glct T A 5: 149,696,437 M19K probably benign Het
Ccdc138 C A 10: 58,540,819 Q425K probably damaging Het
Ccdc178 T A 18: 22,130,122 K143N probably benign Het
Cd200r4 T A 16: 44,832,948 I73K probably benign Het
Chaf1b A G 16: 93,887,142 K94E possibly damaging Het
Cmtm2a T C 8: 104,293,044 probably null Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Fnbp4 C A 2: 90,752,862 N277K probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Itsn1 T C 16: 91,905,380 Y37H probably benign Het
Kdm8 A G 7: 125,455,173 Y16C possibly damaging Het
Kif1b A T 4: 149,222,261 Y881N probably damaging Het
Lhcgr C T 17: 88,772,019 V80I probably benign Het
Lrriq1 T A 10: 103,173,375 L1082F probably damaging Het
Met A G 6: 17,571,744 Y1354C probably damaging Het
Nbea A G 3: 55,628,586 L2859P possibly damaging Het
Ndufaf5 T A 2: 140,202,923 M279K possibly damaging Het
Nlrp4e T C 7: 23,353,272 I872T probably damaging Het
Npnt A T 3: 132,906,840 probably null Het
Nsd1 G A 13: 55,246,148 V521I probably benign Het
Pak6 T A 2: 118,693,912 Y469N probably damaging Het
Parp4 C T 14: 56,647,429 R1322* probably null Het
Pax6 T C 2: 105,685,907 Y177H probably benign Het
Pcdhb4 A T 18: 37,308,989 T451S probably benign Het
Pcdhgb5 A T 18: 37,731,854 D234V probably damaging Het
Pramef6 A G 4: 143,895,853 S311P probably damaging Het
Ralb G A 1: 119,475,956 A147V possibly damaging Het
Rgs11 A G 17: 26,205,181 K196E probably benign Het
Rnft1 A T 11: 86,491,790 T280S probably benign Het
Slco4c1 G T 1: 96,867,834 H166Q probably damaging Het
Sycp3 T C 10: 88,472,935 S248P probably damaging Het
Tab2 A G 10: 7,919,112 probably null Het
Tgm6 T C 2: 130,138,955 M224T probably damaging Het
Topbp1 A T 9: 103,312,804 E193V possibly damaging Het
Trim36 T C 18: 46,169,292 Y551C probably damaging Het
Ttc17 T C 2: 94,362,521 Y628C probably damaging Het
Vmn1r180 A C 7: 23,953,210 D266A possibly damaging Het
Vmn2r104 T A 17: 20,040,719 K481* probably null Het
Zc3hav1 A G 6: 38,307,237 V981A probably damaging Het
Other mutations in Olfr138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Olfr138 APN 17 38274899 missense probably benign 0.01
IGL01874:Olfr138 APN 17 38275517 missense probably benign 0.32
IGL02209:Olfr138 APN 17 38275232 missense probably benign 0.00
IGL03053:Olfr138 APN 17 38274791 missense probably damaging 0.96
IGL03168:Olfr138 APN 17 38274791 missense probably damaging 0.96
R0393:Olfr138 UTSW 17 38274883 missense probably benign 0.00
R0667:Olfr138 UTSW 17 38275157 missense probably damaging 1.00
R1288:Olfr138 UTSW 17 38275223 missense probably benign 0.09
R1567:Olfr138 UTSW 17 38275568 missense possibly damaging 0.87
R1618:Olfr138 UTSW 17 38275666 splice site probably null
R1699:Olfr138 UTSW 17 38275041 missense probably benign 0.39
R1748:Olfr138 UTSW 17 38275106 missense possibly damaging 0.50
R1862:Olfr138 UTSW 17 38275344 missense probably damaging 0.99
R2251:Olfr138 UTSW 17 38274903 missense probably benign 0.01
R3436:Olfr138 UTSW 17 38275530 missense probably damaging 1.00
R4731:Olfr138 UTSW 17 38275547 missense probably damaging 1.00
R4732:Olfr138 UTSW 17 38275547 missense probably damaging 1.00
R4733:Olfr138 UTSW 17 38275547 missense probably damaging 1.00
R5404:Olfr138 UTSW 17 38275626 nonsense probably null
R5443:Olfr138 UTSW 17 38275014 missense probably damaging 0.99
R6058:Olfr138 UTSW 17 38275259 missense probably damaging 0.99
R6061:Olfr138 UTSW 17 38274881 missense probably benign
R6266:Olfr138 UTSW 17 38275148 missense probably benign 0.22
R7520:Olfr138 UTSW 17 38275440 missense probably benign 0.00
R7717:Olfr138 UTSW 17 38275580 missense probably damaging 1.00
R7959:Olfr138 UTSW 17 38275711 makesense probably null
R8256:Olfr138 UTSW 17 38275520 missense probably damaging 0.99
X0024:Olfr138 UTSW 17 38275445 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGAGCTAGCACTTTCTGTGG -3'
(R):5'- CAGAAACGTTTTCAGACTGTTCTTC -3'

Sequencing Primer
(F):5'- GGATGTGCAGTACTTAGAAT -3'
(R):5'- TTCATAAACATAACCCACACTGTTG -3'
Posted On2016-11-09